290 likes | 312 Vues
Test Results. Overall Average : 48 ±14 (6-81) Multiple Choice Average: 25±6 (6-38) Fill in Average:10±4 (0-20) Short Answer/Diagram Average:13±7 (0-35) Question 2 is misgraded, I will adjust for it later. Approximate Pace. 48 is middle C 48+14 (1StD) = 62 is middle B
E N D
Test Results • Overall Average : 48 ±14 (6-81) • Multiple Choice Average: 25±6 (6-38) • Fill in Average:10±4 (0-20) • Short Answer/Diagram Average:13±7 (0-35) • Question 2 is misgraded, I will adjust for it later.
Approximate Pace • 48 is middle C • 48+14 (1StD) = 62 is middle B • 48+28 (2StD) = 76 is middle A • 48-14 (1StD) = 34 is middle D • 48-28 (2StD) = 20 is middle F
Numerical Breakdown • 11 in A range • 25 in B range • 56 in C range • 26 in D range • 9 in F range
Study Tactics • Read Chapter and Study Figures • Study Summary, Key Terms; Questions • Flashcards • Reread chapter carefully in quiet place while taking notes • Create your own outline of chapter • Practice diagrams on paper; the text discusses each step • Quiz study partner • Discuss subjects with friends • Grill your T.A. at recitation about the subject matter
Test Tactics • Assess your strengths/weaknesses • Survey test and determine pace • Fill in high points questions if you know the answers • Rapidly go through MC and fill ins and answer the ones you know • Use remaining time to use the process of elimination to better statistical chances on the remaining multiple choice • Revisit high point questions and try to garner some partial credit • Do not dilute correct pieces with too much random guessing
Syllabus Change • We will only go to Chapter 8 by the end of next week. • Read Chapter 8 by Wednesday
RNA Processing • Prokaryotes • rRNAs • tRNAs • Eukaryotes • rRNAs • tRNAs • mRNAs
Specialized Processing SystemsrRNA Methylation Glycosylation 5S
Eukaryotic mRNA ProcessingSplicing: Two Step Reaction YYYYYYYYYN(C/U)AG|G(G/U) (A/C)AG|GU(A/G)AGU
Eukaryotic mRNA ProcessingSplicing: Spliceosome • snRNAs • 50-200 nt • U1,U2,U5,U6, • snRNPs • snRNA +6-10 proteins
RNA Degradation • Half life of mRNAs • rRNAs and tRNAs: very long • mRNAs • Bacteria : approx. 2-3 minutes • Mammals: < 30 min to >20 hours Transferrin (Fig.6.48)
Proteins • Synthesis: Translation of mRNA • Folding and Processing • Regulation of Function • Degradation
Protein SynthesisDecoding Example AUGUUCGACUGCAACCCCCCGUAA AUGUUCGACUGCAACCCCCCGUAA Met Phe Asp Cys Asn Pro ProStop
Protein SynthesisTransfer RNAs • tRNAs • 70-80 nt • Cloverleaf • Anticodon loop • amino acid attachment site
Protein SynthesisAminoacyl tRNA Synthetases • Approx. 40 • Why not 64? • Why not 61? • Wobble • I can pair with C, U, orA