290 likes | 325 Vues
Explore detailed test results and study tactics for biochemistry students. Learn about approximate pace, numerical breakdown, study tactics, test tactics, and RNA processing insights. Adjust your strategies and excel in your biochemistry course.
E N D
Test Results • Overall Average : 48 ±14 (6-81) • Multiple Choice Average: 25±6 (6-38) • Fill in Average:10±4 (0-20) • Short Answer/Diagram Average:13±7 (0-35) • Question 2 is misgraded, I will adjust for it later.
Approximate Pace • 48 is middle C • 48+14 (1StD) = 62 is middle B • 48+28 (2StD) = 76 is middle A • 48-14 (1StD) = 34 is middle D • 48-28 (2StD) = 20 is middle F
Numerical Breakdown • 11 in A range • 25 in B range • 56 in C range • 26 in D range • 9 in F range
Study Tactics • Read Chapter and Study Figures • Study Summary, Key Terms; Questions • Flashcards • Reread chapter carefully in quiet place while taking notes • Create your own outline of chapter • Practice diagrams on paper; the text discusses each step • Quiz study partner • Discuss subjects with friends • Grill your T.A. at recitation about the subject matter
Test Tactics • Assess your strengths/weaknesses • Survey test and determine pace • Fill in high points questions if you know the answers • Rapidly go through MC and fill ins and answer the ones you know • Use remaining time to use the process of elimination to better statistical chances on the remaining multiple choice • Revisit high point questions and try to garner some partial credit • Do not dilute correct pieces with too much random guessing
Syllabus Change • We will only go to Chapter 8 by the end of next week. • Read Chapter 8 by Wednesday
RNA Processing • Prokaryotes • rRNAs • tRNAs • Eukaryotes • rRNAs • tRNAs • mRNAs
Specialized Processing SystemsrRNA Methylation Glycosylation 5S
Eukaryotic mRNA ProcessingSplicing: Two Step Reaction YYYYYYYYYN(C/U)AG|G(G/U) (A/C)AG|GU(A/G)AGU
Eukaryotic mRNA ProcessingSplicing: Spliceosome • snRNAs • 50-200 nt • U1,U2,U5,U6, • snRNPs • snRNA +6-10 proteins
RNA Degradation • Half life of mRNAs • rRNAs and tRNAs: very long • mRNAs • Bacteria : approx. 2-3 minutes • Mammals: < 30 min to >20 hours Transferrin (Fig.6.48)
Proteins • Synthesis: Translation of mRNA • Folding and Processing • Regulation of Function • Degradation
Protein SynthesisDecoding Example AUGUUCGACUGCAACCCCCCGUAA AUGUUCGACUGCAACCCCCCGUAA Met Phe Asp Cys Asn Pro ProStop
Protein SynthesisTransfer RNAs • tRNAs • 70-80 nt • Cloverleaf • Anticodon loop • amino acid attachment site
Protein SynthesisAminoacyl tRNA Synthetases • Approx. 40 • Why not 64? • Why not 61? • Wobble • I can pair with C, U, orA