ailani
Uploaded by
24 SLIDES
383 VUES
240LIKES

Students Constructing Their Own Knowledge to Understand Mutation

DESCRIPTION

Students Constructing Their Own Knowledge to Understand Mutation Lauren Schultz, Trista Strauch , Tasia Taxis, Lindsey Veautour Facilitator: John Merrill. Background. Please respond as a student in intro bio

1 / 24

Télécharger la présentation

Students Constructing Their Own Knowledge to Understand Mutation

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

Playing audio...

  1. Students Constructing Their Own Knowledge to Understand Mutation Lauren Schultz, TristaStrauch, Tasia Taxis, Lindsey Veautour Facilitator: John Merrill

  2. Background • Please respond as a student in intro bio • You’ve been exposed to basic info about mutation, phenotype, genotype, and central dogma.

  3. 30-Second Sentence Write down a definition of mutation

  4. 1. An organism fails to thrive in its environment. Is this a mutation? Yes A No B

  5. 2. An organism is exceptionally successful in its environment. Is this a mutation? Yes A No B

  6. 3. An organism has a new variant protein that is detrimental. Is this a mutation? Yes A No B

  7. 4. An organism has a new variant protein that is beneficial. Is this a mutation? Yes A No B

  8. 5. There is a genetic change that results in no change in the protein. Is this a mutation? Yes A No B

  9. An organism fails to thrive in its environment. • An organism is exceptionally successful in its environment. • An organism has a new variant protein that is detrimental. • An organism has a new variant protein that is beneficial. • There is a genetic change that results in no change in the protein.

  10. Vote Positive Mutation A Negative Mutation B

  11. Defend your vote to your neighbor

  12. Revote Positive Mutation A Negative Mutation B

  13. Holstein Piedmontese Belgian Blue

  14. Teachable Unit Framework Teaching Challenge Students memorize a definition of mutation as a “change in the genetic material,” but hold onto misconceptions that are at odds with this definition.

  15. Teachable Unit Framework • Learning Objectives • Students will formulate a working definition of a mutation and use it assess whether a mutation has occurred. • Tidbit One- 30 second paper, Guided-Inquiry Clicker Qs • Given various scenarios, students will be able to evaluate whether a mutation will lead to a phenotypic variation. • Tidbit Two- Double-Muscle Cattle Scenario • Students will be able to predict how a given mutation would change an individual’s fitness in a specific environment. • Students will be able to show that mutations comprise the basis of genetic variability in a population.

  16. Tidbit #3 • Sickle-Cell Case Study- Mutations can affect an organism’s fitness based on environment.

  17. Tidbit #3 • A mutation occurs such that there is a single amino acid change in the resultant protein. If an individual has two copies of this mutated gene, an illness occurs that can lead to frequent infections and shortened lifespan. • Individuals with a single copy of this variant have 60% protection against mortality from an endemic disease. Would you expect this gene variant to persist in the population?

  18. Tidbit #4 Coat Color Variation Scenario- Mutations comprise the basis of genetic variability.

  19. Tidbit #4 A small group of animals moves from the mainland to an island, founding a new population. There is no subsequent movement of animals on or off the island. This initial population included coat color variation. Some years afterward, however, a new pattern variation arose that was previously not observed in the population. Following subsequent genetic analysis, it is determined that this haircoat is the result of a new variant of a protein. In simplest terms, how did it arise?

  20. Post Class Formative Assessment Learning Objectives 1 and 2

  21. Post Class Formative Assessment Learning Objectives 3 and 4 You have new variations of haircoat—dark with stripes, dark with no stripes, light with stripes, and light with no stripes. Consider the selective pressures that might exist on an island, and how this variation in coat color and pattern could impact survival and fitness in different habitats on the island. Pick one of the coat colors and describe an environment on this island where you think this variant would have better fitness than the other variants.

  22. Summative Assessment Learning Objectives 1 and 2 ACTGCCTGATACATGTAGGC Based on the sequence above decide whether a mutation occurred, and predict any effect on the population. Suppose the sequence shown above is part of the non-coding portion of a chromosome. The first G from the left in the above sequence changes to an A. Did a mutation occur? Predicted effect on the population: Suppose the sequence shown above is part of the non-coding portion of a chromosome. The first G from the left in the above sequence changes to a C. Did a mutation occur? Predicted effect on the population:

  23. Thank you!

More Related