1 / 40

The Case of the Crown Jewels:

The Case of the Crown Jewels:. Investigate a Crime Scene Using DNA Restriction Analysis (DNA Fingerprinting). Module developed at Boston University School of Medicine. Presented by Dr. Dan Murray. Outline. DNA Structure Restriction Enzymes DNA Fingerprinting

akira
Télécharger la présentation

The Case of the Crown Jewels:

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. The Case of the Crown Jewels: Investigate a Crime Scene Using DNA Restriction Analysis (DNA Fingerprinting) Module developed at Boston University School of Medicine Presented by Dr. Dan Murray

  2. Outline • DNA Structure • Restriction Enzymes • DNA Fingerprinting • Simple Tandem Repeats (STRs) • DNA Synthesis • Polymerase Chain Reaction (PCR)

  3. DNA Structure

  4. What is DNA made of? Nucleotides: Phosphate Sugar Base Carbon atoms of sugar are numbered

  5. Nucleotide 1 Nucleotide 2 Nucleotide 3 Nucleotide 4 = one strand of DNA Note polarity

  6. P S P S P S P S Nucleotide 1 T Nucleotide 2 A Nucleotide 3 C Nucleotide 4 G one strand of DNA

  7. 5’ P S P S P S P S 3’ P S P S P S P S T C A G C T G A 3’ 5’ • Two strands of DNA • Double-stranded DNA • Anti-parallel • Hydrogen bonds • AT or GC pairs

  8. 5’ P S P S P S P S 3’ P S P S P S P S T C A G C T G A 3’ 5’

  9. Restriction Enzymes

  10. Restriction endonucleases • Also called restriction enzymes • Occur naturally in bacteria • Hundreds are purified and available commercially • Named for bacterial genus, species, strain, and type • Example: EcoRI • Genus: Escherichia • Species: coli • Strain: R

  11. Restriction endonucleases • Recognize specific base sequences in DNA • Cut DNA at those recognition sites

  12. Restriction Enzyme Recognition Site • Enzymes recognize specific 4-8 bp sequences • EcoRI 5’…GAATTC…3’ • 3’…CTTAAG…5’ • Recognition sites have symmetry • Some enzymes cut in a staggered fashion • Some enzymes cut in a direct fashion • PvuII 5’…CAGCTG…3’ • 3’…GTCGAC…5’

  13. Products generated by restriction enzymes COHESIVE END CUTTERS (staggered cuts): EnzymeRecognition SiteEnds of DNA After Cut EcoRI 5’…GAATTC…3’ 5’…G AATTC…3’ 3’…CTTAAG…5’ 3’…CTTAA G…5’ PstI 5’…CTGCAG…3’ 5’…CTGCA G…3’ 3’…GACGTC…5’ 3’…G ACGTC…5’ BLUNT END CUTTERS (direct cuts): EnzymeRecognition SiteEnds of DNA After Cut HaeIII 5’…GGCC…3’ 5’…GG CC…3’ 3’…CCGG…5’ 3’…CC GG…5’

  14. Frequency of cutting • Average distance between cuts is: • 4n • where “n” is number of bp’s in recognition site. • 4-base cutter: 44 = 256 bp • 5-base cutter: 45 = 1,024 bp • 6-base cutter: 46 = 4,096 bp • 8-base cutter: 48 = 65,536 bp

  15. DNA Fingerprinting

  16. DNA Fingerprinting Determination of an individual’s unique collection of DNA restriction fragments

  17. How to do DNA FingerprintingThe Big Picture Collect Tissue Sample >20 cells >1000 cells RFLP / Southern blot RFLP / Southern blot PCR Analysis

  18. RFLP Analysis RFLP – Restriction Fragment Length Polymorphism; for related DNA molecules, a difference in DNA fragment sizes after restriction enzyme digestion • Difference results from presence of different DNA sequences • Certain regions of genome are highly variable

  19. A single nucleotide change can make a difference Wild-type allele AGATCT TCTAGA Restriction site Mutant allele AGAGCT TCTCGA Not a restriction site

  20. Example: Sickle-cell allele destroys an MstII site

  21. Need to Analyze only a Small Fraction of Genome • Human genome is too big to analyze: • 3 x 109 base pairs  65,536 bp between cuts • = ~46,000 bands • Most regions of genome are not suitable: • 99.9% of DNA sequence is same from one person to the next • Solutions: • Limit analysis to a few genomic regions • Focus on regions which are highly variable

  22. probe GTCATATGTGTTCATGGCATGGACCGAGTCAATATGCGGCT ATGGCATGGACC How to Focus on Specific Regions of Genome Need a probe: A short single stranded DNA which is complementary to the region of interest ::::::::::::::::::::::::::::::::::::::::: :::::::::::: CAGTATACACAAGTACCGTACCTGGCTCAGTTATACGCCGA A probe will base pair to the region of interest

  23. Southern Blotting

  24. Simple Tandem Repeats (STRs)

  25. Simple Tandem Repeats(STR’s) STR – region of DNA containing tandem copies of di-, tri- or tetranucleotide repeat units. Examples: Dinucleotide repeats: GTGTGTGTGTGT…… Trinucleotide repeats: ACGACGACGACG…… Tetranucleotide repeats: TATCTATCTATC……

  26. More on STRs • Number of repeats varies greatly between individuals • STRs make up 10-15% of the mammalian genome • STRs are also called “microsatellites” • STRs are “junk DNA”

  27. 100 ACT repeats Person 1 ACTACT ACTACT EcoRI EcoRI 400 ACT repeats Person 2 ACTACT ACTACT EcoRI EcoRI Regions of Chromosome Analyzed for DNA Fingerprinting Often Contain STRs EcoRI fragment from Person 2 is 900bp longer than in Person 1

  28. DNA Synthesis

  29. 5 3 5 3 A G T C A G - - - - - - T C A G T C A G T C A G T C A G T C Separate strands Add correct bases 3 3 5 5 5 3 5 5 5 3 3 A G T C A G A G T C A G - - - - - - T C A G T C A G T C A G - - - - - - T C A G T C - - - - - - A G T C A G T C - - - - - - T C A G T C 3 3 3 5 3 5 3 5 5 DNA Replication is Semi-Conservative

  30. Building a Strand of DNA • DNA polymerase – enzyme that synthesizes DNA • DNA polymerase can only add nucleotides to the 3´ end of a strand • DNA polymerase cannot build a new strand without a primer

  31. ss DNA 3´ 5´ DNA Polymerase Needs a Primer + Nucleotides (dNTPs) + DNA polymerase = No DNA synthesis

  32. primer 5´ 3´ DNA Polymerase Needs a Primer ss DNA 3´ 5´ + Nucleotides (dNTPs) + DNA polymerase = No DNA synthesis DNA synthesis

  33. DNA Polymerase Needs a Primer primer 5´ ss DNA 3´ 5´ + Nucleotides (dNTPs) + DNA polymerase = DNA synthesis

  34. Polymerase Chain Reaction (PCR)

  35. How to do DNA FingerprintingThe Big Picture Collect Tissue Sample >1000 cells >20 cells RFLP / Southern blot PCR Analysis PCR Analysis

  36. PCR Purpose – Quickly make many copies of a region of a DNA molecule Method – Multiple rounds of DNA replication Components in PCR reaction – Target DNA, nucleotides, DNA polymerase, and primers Temperature cycling – DNA replication controlled by temperature…

  37. Temperature Cycling in PCR Temperature cycling – PCR process uses a machine (thermocycler) in which PCR reaction goes through ~30 cycles of three different temperature changes: ~95ºC – Melting temperature 50-65ºC – Annealing temperature 72ºC – Extension temperature

  38. Polymerase chain reaction (PCR) analysis • 1). primers are designed to flank the region to be amplified in target DNA • 2). primers are annealed to denatured DNA • 3). DNA is synthesized using Taq polymerase (from Thermus aquaticus) • 4). primers are annealed again and the process is repeated through • 20-30 cycles, geometrically amplifying the target sequence • 5). DNA is analyzed by gel electrophoresis 1). 2). 3).

  39. 4).

More Related