albert
Uploaded by
17 SLIDES
528 VUES
170LIKES

The Polymerase Chain Reaction

DESCRIPTION

The Polymerase Chain Reaction Polymerase Chain Reaction Developed by Kary Mullis in mid-1980’s Revolutionary methods of gene analysis Enablement of production of enormous numbers of copies of a specified DNA sequence without the reliance to cloning PCR amplifies specific regions of DNA

1 / 17

Télécharger la présentation

The Polymerase Chain Reaction

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. The Polymerase Chain Reaction

  2. Polymerase Chain Reaction • Developed by Kary Mullis in mid-1980’s • Revolutionary methods of gene analysis • Enablement of production of enormous numbers of copies of a specified DNA sequence without the reliance to cloning

  3. PCR amplifies specific regions of DNA • Exploitation of certain features of DNA replication • Specifically, DNA polymerase which uses ssDNA as template for synthesis of a complementary new strand

  4. DNA review • dsDNA strand is held together by weak hydrogen bonds between 2 of 4 nitrogenous bases that are complimentary to one another • Adenine-Thymine • Cytosine-Guanine • Strands are anti-parallel, 5’  3’ counter to 3’  5’

  5. PCR amplifies specific regions of DNA • Utilization of a cyclical run of temperature fluctuations thereby allowing the newly created dsDNA to serve as a template for further daughter DNA strands • ssDNA templates are produced by heating the dsDNA to be point of boiling (step 1) • Requirement of DNA polymerase of a small section of dsDNA to initiate or “prime” the synthesis (step 2)

  6. Primers • Selection of primers based on sequences juxtaposed on both sides of the target of interest • Two primers should be designed; one for each strand • 18-24 bp • Both primers should have similar Tm • Purine:Pyrimidine content: as close as 1:1 (40-60%) • Avoiding primer-primer interactions • Cooling of reaction after denaturation (step 1) to allow primers to bind or “anneal” to the ssDNA template • Mg++ affects the annealing of the primer to the template DNA by stabilizing the primer-template interaction, it also stabilizes the replication complex of polymerase with template-primer

  7. Primers 5’…CTATGGATAAGATGAGAGGACTA………AATGTATGAGAGAGTAATAGAGAG…3’ 3’…GATACCTATTCTACTCTCCTGAT……….TTACATACTCTCTCATTATCTCTC…5’ step 1 (denature) 5’…CTATGGATAAGATGAGAGGACTA………AATGTATGAGAGAGTAATAGAGAG…3’ 3’…GATACCTATTCTACTCTCCTGAT……….TTACATACTCTCTCATTATCTCTC…5’ step 2 (anneal) 5’…CTATGGATAAGATGAGAGGACTA………AATGTATGAGAGAGTAATAGAGAG…3’ 3’ACTCTCTCATTATCTC5’ 3’…GATACCTATTCTACTCTCCTGAT……….TTACATACTCTCTCATTATCTCTC…5’ 5’GGATAAGATGAGAGG3’ step 3 (extend) 5’…CTATGGATAAGATGAGAGGACTA………AATGTATGAGAGAGTAATAGAGAG…3’ 3’…TACATACTCTCTCATTATCTC5’ 3’…GATACCTATTCTACTCTCCTGAT……….TTACATACTCTCTCATTATCTCTC…5’ 5’GGATAAGATGAGAGGACTA…3’

  8. Extension • Use of taq DNA polymerase to synthesize new strand of DNA, complementary to template, that extends to a variable distance from the primer binding site, using the available separate deoxynucleotides in the reaction • dATP, dCTP, dTTP, dGTP • taq DNA polymerase has a higher error rate (no proof-reading 3' to 5' exonuclease activity)

  9. Cyclic reaction • Post-extension involves the repeat of the entire process which causes the newly formed dsDNA to denature • The newly synthesized dsDNA are separated into ssDNA, and 4 binding sites are available for primers to anneal • Taq polymerase synthesizes the new complementary strand, however, the extension of these new strands is limited to the target sequence

  10. Amplification of target sequence only extension (step 3) denature (step 1)

  11. Amplification of target sequence only annealing (step 2) extension (step 3)

  12. Exponential Amplification

  13. Resolving PCR products • Polyacrylamide gel electrophoresis • Higher resolving power; separation of DNA molecules whos lengths differ by as little as .2% • Accommodation of higher quantities of DNA (up to 10 ug) without resolution loss • Higher purity of DNA can be extracted • Nondenaturing PAGE gels for separation and purification of dsDNA fragments • However, electrophoretic mobility is affected by base composition (in addition to size) • Denaturing PAGE gels for separation and purification of ssDNA fragments • Usually urea, formamide is used to suppress base pairing in nucleic acids • Denatured DNA migrates at a rate independent of base composition

  14. Resolving PCR products • Agarose gel • Lower resolving power, but greater range of separation (200 bp to 50 kb) • Buffers • TAE (tris acetate) has low buffering capacity (ionic strength) • TBE (tris borate) and TPE (tris phosphate) have higher buffering capacity

  15. Resolving PCR products • Visualization of DNA via fluorescence • Ethidium bromide • Insertion between the bases of the DNA • EtBR:DNA complex displays an increase fluorescent yield compared to dye in free solution • Yield is lower for ssDNA

  16. Metaphor Agarose • Intermediate melting temperature • 2x resolution capabilities of agarose • Resolution of products differing in size by 2%, in the range of 200 bp to 800 bp

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer