ann
Uploaded by
54 SLIDES
1374 VUES
600LIKES

DNA replication

DESCRIPTION

1 ADN  2 ADN. DNA replication is semi-conservative DNA polymerases Replication origins Assembly of the replication fork. DNA replication. Further readings :. http://www.dnaftb.org/dnaftb/. http://www.dnareplication.net/. DNA replication is semi-conservative.

1 / 54

Télécharger la présentation

DNA replication

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. 1 ADN  2 ADN • DNA replication is semi-conservative • DNA polymerases • Replication origins • Assembly of the replication fork DNA replication Further readings : http://www.dnaftb.org/dnaftb/ http://www.dnareplication.net/

  2. DNA replication is semi-conservative M. Meselson & P Stahl Proc. Nat. Ac. Sci. 1958

  3. The cell cycle G0 Mitosis In the resting state (G0), cells do not divide Gap 2 Gap 1 DNA Synthesis 3

  4. GGATC GGATCCTTAGAACCTTGGCCCGGG CCTAGGAATCTTGGAACCGGGCCC CCTAGGAATCTTGGAACCGGGCCC template DNA synthesis is catalyzed by DNA-dependent DNA polymerases DNA polymerase dATP PPi PPi nucleotides dTTP PPi PPi PPi dCTP PPi primer dGTP 5’ 5’ • DNA polymerization takes place in the 5’ to 3’ direction • DNA polymerase requires a template and a primer dNTP template strand strand to be synthesized 4 Stryer et al. Biochemistry, Freeman Edt

  5. DNA replication requires a primase to start • DNA replication is catalyzed by a DNA-dependant DNA polymerase in the 5 ’ to 3 ’ direction starting at double strand DNA or at a DNA-RNA hybrid • A primase synthesize a RNA primer to initiate replication • DNA polymerases are processive : processivity is the number of phosphodiester bonds that a single enzyme is able to catalyze before dissocation dNTP template strand strand to be synthesized

  6. Leading and lagging strands Okazaki fragments RNA primase Size of Okasaki fragments : eukaryotes 200 bp 6 Alberts et al. MBOC, Garland Edt

  7. On the « leading strand », DNA is continuously synthesized Replication fork primase DNA helicase NTP 3’ 5’ RNA primer DNAPol d DNA helicase dNTP 3’ 5’ 7

  8. DNA helicase DNA helicase DNA helicase DNA helicase On the « lagging strand », DNA is synthesized discontinuously Replication fork DNAPol a primase RNA primer NTP 5’ 3’ DNAPol e RNA primer dNTP 5’ 3’ RNAse and DNAPol e RNA primer dNTP 5’ 3’ RNA primer ligase 5’ 3’ 8

  9. The core of the eukaryote replication complex DNAPol d DNAPol a primase DNAPol e Movies 5.1 (Molecules and Complexes) and 5.4 (Cell functions) Mol. Biol. Cell Linda B. Bloom, University of Florida http://www.med.ufl.edu/IDP/BMB/bmbfacultypages/lindabloom.html • Eukaryote cells possesses several DNA polymerases (> 15) a nucleus 250 kDa DNA primase, lagging strand d nucleus 170 kDa leading strand e nucleus 260 kDa lagging strand,DNA repair 9

  10. Main components of the DNA replication complex The catalytic core DNA polymerase a – primase primer RNA synthesis DNA polymerase d, e DNA synthesis, leading+lagging strands Replication protein C* load PCNA on DNA Proliferating cell nuclear antigen (PCNA) sliding clamp ensuring processivity Topoisomerase Adjusts DNA supercoiling Helicase* Unwinds DNA into strands Replication protein A single strand DNA binding protein Flap endonuclease 1 removes RNA 5’-flap Dna2 RNase H1 removes RNA DNA ligase 1 joins Okasaki fragments * uses ATP The replisome Cyclin A, cyclin B1 Cyclin dependent kinase 1, 2 (CDK1, CDK2) + 11 other proteins… Temporal regulation Maga and Hübscher 1996 Biochemistry 35: 5764-5777 Waga and Stillman 1994 Nature 269: 207-212 Frouin et al. 2003 EMBO reports 4: 666-670 Hübscher and Yeon-Soo Seo 2001 Mol. Cells 12: 149-157 10

  11. The central role of PCNA • PCNA (proliferating cell nuclear antigen) is a homotrimeric protein that helps DNA polymerase processivity in eukaryotic cells. During the S-phase, it assembles around DNA and form a DNA clamp. • PCNA associates with RFC, DNA polymerases d and e, Fen1/Dna2, Lig1 (+ 15 other proteins !) • PCNA is also involved in DNA repair mechanisms At 3’ OH end : RFC displaces Pol-a and loads PCNA + Pold/e At the flap structure : RFA dissociates Pole from PCNA PCNA recruits Fen1/Dna2 which cleaves the flap structure PCNA recruits Lig1 that joins the DNA fragments PDB 1AXC Maga and Hübscher 2003 Journal of Cell Science 116: 3051-3060 11

  12. Replication is coordinated at replication factories • Visualization of DNA replication in living cells using GFP-PCNA • FRAP experiments shows that PCNA is stably associated to replication factories GFP PCNA 12 Essert et al. 2005 Mol. Cell Biol. 25 : 9350-59

  13. Replication is coordinated at replication factories • Visualization of DNA replication in living cells using GFP-PCNA • FRAP experiments shows that PCNA is stably associated to replication factories 13 Essert et al. 2005 Mol. Cell Biol. 25 : 9350-59

  14. ORC : origin replication complex MCM : minichromosome maintenance complex Replisome Replication starts at replication origins 1. Activation 2. Extension 3. Termination • There are about 100-1000 replication origins per chromosome • Replication origins are recognized by specific protein complexes : ORC ‘origin recognition complex) and MCM (minichromosome maintenance complex) • Replication speed : 10-50 bp/s • The onset of DNA replication is triggered by « cell division cycle dependant kinases » (CDK) 14

  15. DNA repair • Molecular origin of DNA mutations • General repair mechanisms • The p53 protein controls DNA damage at a specific checkpoint of the eukaryote cell cycle

  16. Sources of DNA damage Replication errors: DNA polymerase frequency 1/107 Molecular damages to DNA: Origin DNA damage number/cell.day Possible repair Exogenous sun (1h/day) T-T dimers 6-8.104 Y chemical adducts 102-105N (base modification) radioactivity single strand breaks 2-4.104 Y (natural double strand breaks ? ± background) Endogenous temperature single strand breaks 2-4.104 Y free radicals adducts/breaks 104 Y metabolites adducts 102 Y viruses genome integration ? N transposons ? ?

  17. DNA repair mechanisms Damage type Repair • Recognition T-T dimers Adducts Single strand breaks Double strand breaks • Restriction • Excision • Synthesis • Ligation • Excision • or direct ligation • Recombination • Ligation

  18. The COMET assay to measure DNA damages also called single cell gel electrophoresis (SCGE)

  19. Ames test (Salmonella-his reversion-test ) for mutagenicity This experiment employed six strains of Salmonellatyphimurium histidine auxotroph mutants, deficient in the synthesis of histidine, an amino acid necessary for bacterial growth. The histidine auxotrophs will only grow in a medium containing sufficient histidine supplement. To revert to histidine production (prototrophy), or become his+,a reverse mutation must occur in the original his- mutation (found in one of the genes involving histidine biosynthesis). When plated onto an agar media containing a trace (1/1000 dilution) of histidine, only his+ revertants will grow to form a visible colony. The presence of visible colonies signifies a reverse mutation. Each of the six bacterial strains carries a different type of mutation (Table 1), making it possible to assess the type of mutation caused by the chemical under examination. When a chemical mutagen is introduced into the bacterial population on a filter disc, a higher number of revertants will appear, signalling the chemical causes genetic mutations. The Ames test includes using liver extract to simulate mammalian metabolic activity which may alter non-mutagenic chemicals to become mutagenic. The liver extract is generally obtained from rats treated with Aroclor 1254 to induce the presence of detoxifying enzymes. Brian Krug: Ames Test: Chemicals to Cancer chemical to be tested Inhibition zone growth ring Strain # S. typhimurium Type of Mutation Detected Strain Name 1 TA98 detect frame-shift mutations 2 TA100 detect base pair substitutions 3 TA102 detect excision repair 4 TA104 detect base-pair substitutions 5 TA1534 detect frame-shift mutation 6 TA1530 detect base pair substitutions

  20. Exemple of repair : thymine dimers (induced by UV light) Tymine dimer repair enzyme : specific DNA endonuclease

  21. translocation to the nucleus aromatic molecule (L) Aryl hydrocarbon Receptor AhR AhR-L AhR-L AhRE AhRE induction of specific mRNA (AhRE) P450 cytochromes (phase I) : CYP1A1, CYP1A2, CYP1B1, CYP2S1 Phase II enzymes : GST, UGT (detoxification mechanism) Growth Differentiation Metabolism (toxicity) CYP1A1, CYP1A2 epoxide hydrolase the diol epoxide covalently binds to DNA (adduct) Increased DNA mutations & cancer benzo[a]pyrene-7,8-dihydrodiol -9,10-epoxide Metabolism et carcinogenicity of Benzo[a]Pyrene Benzo[a]pyrene is a product of incomplete combustion at temperatures between 300 and 600 °C. benzo[a]pyrene (BP)

  22. Shimizu et al. (2000) PNAS 97 : 779-782 Benzo[a]pyrene carcinogenicity is lost in mice lacking the aryl hydrocarbon receptor Individual susceptibility to xenobiotics. Exemple of CYP genes Dossier INSERM Dioxines dans l’environnement. Quels risques pour la santé? http://ist.inserm.fr/basisrapports/rapport.html

  23. ADN1 + ADN2  ADN3 + ADN4 • Molecular mechanisms of homologous recombination • Site specific recombination • Conjugation, mechanism of bacterial parasexuality • The VDJ recombination, one of the mechanisms that generate antibody and TCR diversity • The crossing-over at meiosis increases genomic diversity in the population • Transposons and viruses are mobile DNA/RNA sequences DNA recombination : programmed random modifications of the genome

  24. 1. Homologous recombination Condition : presence of two homologous sequences in adjacent chromosomes or DNA molecules

  25. The mechanism of homologous recombination homology Holliday junction cleavage 1 exchange cleavage 2 ligation displacement (branch migration) ligation

  26. RecA proteins catalyze the exchange of DNA strands ... Structure of a RecA polymer ATP hydrolysis ATP binding site

  27. … in the 5’ to 3’ direction without RecA with RecA … dans un seul sens Driving force : ATP hydrolysis

  28. Recombination events in cells Example Cells Effect Effector proteins Crossing-over Meiotic cells genome RecA-D like ( germinal cells) rearrangements proteins Virus integration Host cell genome dormancy Integrase lytic/lysogenic Integration Host phases Factor Conjugation Bacteria gene exchange Integrase VDJ recombination lymphocytes antibody and Rag1-2 TCR diversity Transposons all cells genome Transposases rearrangements

  29. Mitosis, meiosis and fecundation example of a diploid organism with 2 pairs of homologous chromosomes diploid gametes diploid 2 haploids 2 diploids diploid 4 haploids MITOSIS FECUNDATION MEIOSIS 29

  30. Mitotic spindle separation of sister chromatides DNA replication decondensation of chromosomes Chromosome condensation centromeres separation of daughter cells (cytokinesis) Sister chromatides Mitosis : 1 diploid -> 2 diploids 30

  31. DNA replication Chromosome condensation centromere Sister chromatids Meiosis : 1 diploid -> 4 haploids synaptolemalcomplex Pairing of homologous chromosomes 1st mitosis separation of homologous chromosomes 2nd mitosis gametes 31

  32. DNA replication Chromosome condensation centromer sister chromatids Recombination during meiosis synaptolemal complex Pairing of homologous chromatids and crossing-over 1st mitosis segregation of homologous chromosomes 2ndmitosis gametes 32

  33. « Crossing over » simple paternal chromosome maternal chromosome • homologous sequence • frequency : 1/107 base pairs, at least one per chromosome double Non-Mendelian transmission Mitochondrial DNA transmission • Exclusive transmission of mother mitochondria Epigenetics • Some genes are inactivated by methylation, the methylation state can be transmitted to daughter cells. • Example : inactivation of one chromosome X in women 33

  34. blasticidineR target gene Recombination (double crossing-over) blasticidineR WT Dphg1a Dphg1b Dphg1a/b PHG1A ampicillineR Anti-PHG1A PHG1B Anti-PHG1B Benzhegal et al. 2002 Application of recombination : gene knock-out by insertion

  35. 2. Site-specific recombination Condition : presence of a specific sequence repeated twice Mechanism : specialized protein complex, no branch migration

  36. Specific case : recombination with a circular DNA molecule • Simple recombination • Double recombination • Recombination with circular DNA : local double recombination (no branch migration)

  37. Example 1 : site-specific recombination of a virus The two states of the bacteriophage l Reversible recombination DNA of the bacterio phage l attP DNA of E. coli attB ExcisionaseIntegrase Integration Host Factor Integrase Integration Host Factor Recombinant DNA

  38. Integrase mechanism phage l DNA attP E. Coli DNA attB recombinant DNA pairing, double cleavage, double exchange, ligation

  39. phage DNA attB attP bacterial DNA Conformation 1 : phage and bacterial DNA separated Conformation 2 : phage and bacterial DNA fused

  40. integration Phage integration in bacterial genome excision Biswas et al. (2005) A structural basis for allosteric control of DNA recombination by λ integrase Nature 435 : 1059-1066

  41. Example 2. The F-factor allows gene exchange between bacteria Conjugation Reversible recombination factor F « female » bacterial chromosome integration DNA Hfr chromosome excision « male » plasmide F ’ episome F • F’ plasmids often carry virulence factors

  42. Example 3 : genetic rearrangements in B lymphocytes Example : light chain k of antibodies recombination splicing RAG : recombination activating genes RSS : recombination signal sequences

  43. In every V-region recombination event, the signals flanking the gene segments are brought together to allow recombination to take place. Immunobiology: The Immune System in Health and Disease. 5th Ed.Janeway CA et al. New York: Garland Science; 2001. In some cases, as shown in the left panels, the V and J gene segments have the same transcriptional orientation. Juxtaposition of the recombination signal sequences results in the looping out of the intervening DNA. Heptamers are shown in orange, nonamers in purple, and the arrows represent the directions of the heptamer and nonamer recombination signals. Recombination occurs at the ends of the heptamer sequences, creating a signal joint and releasing the intervening DNA in the form of a closed circle. Subsequently, the joining of the V and J gene segments creates the coding joint. In other cases, illustrated in the right panels, the V and J gene segments are initially oriented in opposite transcriptional directions. Bringing together the signal sequences in this case requires a more complex looping of the DNA. Joining the ends of the two heptamer sequences now results in the inversion and integration of the intervening DNA. Again, the joining of the V and J segments creates a functional V-region exon.

  44. Applications of recombination : the Cre-Lox system Cre recombinase : a P1 phage enzyme that catalyzes recombination between two LoxP sequences : LoxP : ATAACTTCGTATAGCATACATTATACGAAGTTAT Example : RIP-CreER transgenic mice have a tamoxifen inducible Cre-mediated recombination system driven by the rat insulin 2, Ins2, promoter. The transgene insert contains a fusion product involving Cre recombinase and a mutant form of the mouse estrogen receptor ligand binding domain. The mutant mouse estrogen receptor does not bind natural ligand at physiological concentrations but will bind the synthetic ligand, 4-hydroxytamoxifen. Restricted to the cytoplasm, the Cre/Esr1 protein can only gain access to the nuclear compartment after exposure to tamoxifen. When crossed with a strain containing a loxP site flanked sequence of interest, the offspring are useful for generating tamoxifen-induced, Cre-mediated targeted deletions. Tamoxifen administration induces Cre recombination in islet cells of the pancreas. About 100 loxP-flanked genes bearing strains are available at Jackson

  45. Mating Inducible tissue specific promoter

  46. 3. Transposon and viruse integration in the genome Condition : random (?) integration in the genome Mechanism : specialized protein complex, no branch migration, duplication of ends

  47. Transposons are mobile DNA sequences in genomes transposase transcription traduction excision insertion example : Tn5 transposon and transposase

  48. The presence of transposons allows gene duplication, inversion or excision by homologous recombination DELETION INVERSION DUPLICATION

  49. Viruses and transposons Transposons Viruses • no specific insertion sites • frequency of mobility: 10-6 per generation • Abundance variable in genomes (10% in drosophila, 40% in men) • coat proteins • use receptors to enter the cells type I transposons (retrotransposons) RNA viruses type II transposons DNA viruses

  50. Fast and slow viruses • Fast viruses Production of viral proteins and nucleic acids, formation of new virus particle Cell death Virus entry by fusion of the virus envelope with the plasma membrane thanks to cell receptors For RNA viruses, a reverse transcriptase copy their RNA into DNA The virus takes control of the cell • Slow viruses Genome integration Silent expression Dormancy

More Related