azana
Uploaded by
40 SLIDES
994 VUES
420LIKES

Gene Synthesis using DNAWorks

DESCRIPTION

Gene Synthesis using DNAWorks. Dr. David Hoover Helix Systems, SCB, CIT, NIH. Gene Synthesis. Several methods ligation - incredibly tedious and inefficient FokI - sequence dependent (type IIs r.e.) serial cloning - sequence dependent assembly or self-priming PCR. Gene Synthesis Methods.

1 / 40

Télécharger la présentation

Gene Synthesis using DNAWorks

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

Playing audio...

  1. Gene Synthesis using DNAWorks Dr. David Hoover Helix Systems, SCB, CIT, NIH

  2. Gene Synthesis Several methods • ligation - incredibly tedious and inefficient • FokI - sequence dependent (type IIs r.e.) • serial cloning - sequence dependent • assembly or self-priming PCR

  3. Gene Synthesis Methods Thermodynamically Balanced Conventional Thermodynamically Balanced Inside-Out

  4. Protein Expression Protein/Structure Independent Factors: • promoters and upstream elements • translational initiation and termination • mRNA stability • codon bias Protein/Structure Dependent Factors: • folding and aggregation • proteolysis and degradation • secretion and localization

  5. Codon Bias

  6. Synthetic Genes Benefits: • Codon use optimized for host • Flexibility in subcloning • Ease of complex mutagenesis Problems: • Time consuming • Complicated • Error-prone

  7. Commercial Sources Blue Heron Biotechnology (http://www.blueheronbio.com) DNA 2.0 (http://www.dna20.com/) Gene Script Corporation (http://www.genscript.com/) BioNexus Inc. (http://www.genesynthesis.net/) Entelechon (http://www.entelechon.com/) GeneArt (http://www.geneart.com/) Codon Devices (http://www.codondevices.com/)

  8. Commerical Sources Typical costs: • $0.79 - $3.60 / bp • Complexities? • Intellectual property? • 800 bp = $1000 (Gene Script)

  9. Genes From Scratch • oligos ~ $0.20 / nt (NIH discount) • PCR reagents ~ $2 / reaction • sequencing ~ $20 / 600 bp • electrophoresis ~ $3 / gel • labor ~ $20 / hr GFP, 238 aa, 714 bp, 20 oligos, 1134 nt, 2 reactions, 2 gels, 4 sequences, ~10 hrs = $517

  10. How to design oligos reverse-translate protein into DNA, optimum codon usage break into fragments of equal overlap Tm optimize: • hairpins / mRNA structure • repeats / mispriming • restriction site inclusion / exclusion • length

  11. DNAWorks http://helixweb.nih.gov/dnaworks/

  12. DNAWorks Output 181 TCTGGTGAAGGCGAGGGTGACGCGACCTACGGTAAACTCACTCTCAAAT agaccact TGCCATTTGAGTGAGAGTTTAAGTAGACGTGG <--- 4 S G E G E G D A T Y G K L T L K F I C T | | | | | | | 7 ---> 241 ggttccttggccgaccctggttactaccttctcttacggtgttcag TGCCCGTTTGACGGCCAAGGAACCGGCTGG tc <--- 6 T G K L P V P W P T L V T T F S Y G V Q | | | | | | |

  13. DNAWorks Options • Job Name • E-mail Address

  14. DNAWorks Options Codon Frequency Table • E. coli (standard, class II), H. sapiens, C. elegans, D. melanogaster, M. musculus, P. pastoris, R. norvegicus, S. cerevesiae, X. laevis • Custom CFT

  15. Gly GGG 599428.00 16.49 0.25 Gly GGA 597986.00 16.45 0.25 Gly GGT 392298.00 10.79 0.16 Gly GGC 814464.00 22.41 0.34 Glu GAG 1441162.00 39.65 0.58 Glu GAA 1043166.00 28.70 0.42 Asp GAT 789799.00 21.73 0.46 Asp GAC 914677.00 25.16 0.54 Val GTG 1028789.00 28.30 0.46 Val GTA 257442.00 7.08 0.12 Val GTT 399567.00 10.99 0.18 Val GTC 528840.00 14.55 0.24 Ala GCG 271820.00 7.48 0.11 Ala GCA 579156.00 15.93 0.23 Ala GCT 672416.00 18.50 0.26 Ala GCC 1018345.00 28.02 0.40 Arg AGG 432954.00 11.91 0.21 Arg AGA 434655.00 11.96 0.21 Ser AGT 441137.00 12.14 0.15 Ser AGC 706723.00 19.44 0.24 Lys AAG 1163126.00 32.00 0.57 Lys AAA 879684.00 24.20 0.43

  16. DNAWorks Options Parameters • Annealing Temperature • Oligo Length (random) • Codon Frequency Threshold (random, strict, scored) • Oligonucleotide, Na+/K+, Mg2+ Concentrations • Number of Solutions • TBIO • No gaps in assembly

  17. DNAWorks Options Balancing act • Fast, simple, cheap? • Slow, complex, expensive? - reliable • Reusable and interchangeable oligos?

  18. DNAWorks Options Others • Restriction Site Screen (non-degenerate, degenerate sequences) • Custom Site Screen (mind the format!) • Weights (experimental)

  19. DNAWorks Options Sequences • protein (X = stop) • nucleotide (can be degenerate) • almost any file format • reverse sequence • fix sequence in gap

  20. DNAWorks Output Web output • Input for DNAWorks (standalone version) • Header • Initial parameters • Optimization log • Final scores • Final summary

  21. DNAWorks Output Total output • Sequence blocks • CFT blocks • Pattern block • Trials • Final Summary

  22. DNAWorks Output Trial outputs • Initial parameters • Final DNA sequence • Assembly • Final scores • Codon report • Histograms • Oligo sequences

  23. Scores / Penalties • codon usage • length • melting temperature • repeat • pattern • mispriming • AT/GC contents • gapfix

  24. Mutant Run • Design oligos based on previous set of oligos • Parameters taken from previous run • For single mutation, will output 1 or 2 oligos only

  25. What to look for Final Summary • Avoid misprimes and repeats • Make sure overlaps are > 12 nt (Short) • Tm range should not be > 3°C (TmRange) Don't depend entirely on scores • Arbitrary, somewhat dependent on length

  26. Tricks Choosing codons • random - slower optimization, less constrained • strict - for the fussy • scored - if codon score really matters Tm, Length ranges, Number of Solutions • To find the "very best" solution • no more than 999

  27. Tricks Design multi-use and interchangeable oligos • Flanking primers with standard overlaps • Intersperse nucleotide elements between protein elements • Gap-fix restriction sites • Allow for mutations later on Random mutagenesis • Nucleotide sequences can be degenerate

  28. Tricks Thermodynamically Balanced Inside-Out Mode • Multi-step PCR • More controlled, reliable method • Gao X., et al., Nucleic Acids Res 2003 Random oligo lengths • Faster, better optimization • For the not-so-fussy • Probably best for DNA-only genes

  29. Tricks Set Tm higher • 64°C - 70°C • longer oligos, extra purification ($$$)

  30. Always double check! Nothing is foolproof • Think carefully about what you need BEFORE starting work • Always run final sequences through alternate program (EMBOSS, GCG-Lite) • Make sure oligos are what you intended

  31. PCR • Mix all oligos and additives • Specific PCR protocols • Analytical gel • Isolate desired products

  32. Assembly Protocol

  33. Amplification Protocol

  34. Problems • No product (complete failure) • Wrong size product (mispriming) • Mutations (2 out of 3 correct, 2 errors/kb) Sequencing is warranted...

  35. Fixes • Optimize PCR conditions • Break gene synthesis into steps (TBIO)

  36. Errors p = mutation rate / 1000 nt / duplication (Cline et al., Nucleic Acids Res 24 (1996)) Taq polymerase = 0.008 KOD (Novagen) = 0.0027 PfuUltra (Stratagene) = 0.00043 The probability of a gene n bp in length having no errors using a polymerase with mutation rate p: p' = (1 - p)n Therefore, p' for a 738 bp gene = (1 - 0.00043)738 = 0.728

  37. Errors The number of clones needed to screen to find a correct gene with 95% confidence: N = log(0.05)/log(1-p') Thus, log(0.05)/log(1-0.728) = 3 clones need to be sequenced. From Wu et al., J Biotech 124 (2006)

  38. Time • Find protein of interest, design oligos, order oligos • Run PCR, integrate into sequencing vector, transform • Pick colony, grow overnight culture • Miniprep construct, integrate into expression vector, transform • Pick colony, grow overnight culture • Run expression growth trials ~ 1 week between concept and initial trial (at best!!) Can be automated and parallelized (96 well plates?)

More Related