GENETICS
E N D
Presentation Transcript
GENETICS Mendel’s expt. Incomplete Dorminant Codorminance Multiple allele Linkage and Sex Link Crossover Genetic Variation Mendel
SSSsSsss Monohybrid(Law of Sgregation) ?
Law of Independent Assortment Dihybrid RrYy x RrYy
Backcross(self-pollination) TT x TT Tt x Tt T T T t T t TT TT Tt Tt tt T: tall pea t: short pea
To test animals with dominant characteristics(LL or Ll) Test cross LL x l l Ll x l l L L l l L l l l Ll Ll Ll Ll Ll ll Ll ll
Incomplete Dominance RR rr Rr
Blood cells antigen Blood group Codominance AB O A B
AB O A B A B i Multiple allele Phenotype Genotype A B Types of allele: i Dominant gene: Recessive gene:
Person: 1 2 3 4 Ai i i Bi Ai Blood Group: Tonque roll : Tt Tt Tt tt
B Blood transfusion White blood cell B A Antibody A Red blood cell with antigen A
Ans: yellow flower red fruit : white flower yellow fruit 3 : 1 Y: yellow flower, y: white flower, R: red fruit, r: yellow fruit Linkage If: YyRr x YyRr According to Law of independent assortment, the ratio should be 9:3:3:1. Why? Allele of flower color and allele of fruit color are on the same chromosome.
F1 generation Y Y y y Gamete R r R r F2 generation Genotype: Y Y Y Y y y y y r r R R R r R r Y Y y y Phenotype: Yellow flower Red fruit R r R r Ratio: 3 : 1
XBXb x XBY Male Gamete Female Gamete
Haemophilia SAME AS COLOR BLINDNESS
Blood group AB O A B Blood cells antigen Continuous and DiscontinuousVariation
Environmental Effect Temperature
Chromosome Mutation MUTATION
AACCGTGGACAACCTTGGAC Gene Mutation Change of a gene sequence Cause: Sickle Cell anaemia
Radiation: high energy particles as and also UV light. UV can combine TT nucleotide in DNA chain and so affect replication and transcription. Mutagen Mutagen is any agents which cause mutation. Chemical: colchicine inhibit spindle formation and cause polyploidy, formaldehyde, nitrous acid and mustard gas.