blaise
Uploaded by
1 SLIDES
144 VUES
10LIKES

Molecular Networks Regulated by Tumor Suppressive MicroRNA-375 in Head and Neck Squamous Cell Carcinoma

DESCRIPTION

This study investigates the role of microRNA-375 (miR-375) in head and neck squamous cell carcinoma (HNSCC). Our findings reveal that miR-375 is significantly down-regulated in cancer tissues compared to normal epithelium. Functionally, miR-375 inhibits cancer cell proliferation and induces apoptosis. Through molecular target analysis, we identified LDHB and MTDH as critical gene targets regulated by miR-375, linking them to oncogenic processes in HNSCC. This research provides new insights into the tumor-suppressive mechanisms of miR-375 and its potential as a therapeutic target.

1 / 1

Télécharger la présentation

Molecular Networks Regulated by Tumor Suppressive MicroRNA-375 in Head and Neck Squamous Cell Carcinoma

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

Playing audio...

  1. Molecular networks regulated by tumor suppressive microRNA-375 in head and neck squamous cell carcinoma Abstract #137 Takashi Kinoshita1,2, Toyoyuki Hanazawa1, Nijiro Nohata1,2, Naoko Kikkawa1, Miki Fuse2, Takeshi Chiyomaru3, Hirofumi Yoshino3, Hideki Enokida3, Masayuki Nakagawa3, Yoshitaka Okamoto1, Naohiko Seki2 1Department of Otorhinolaryngology / Head and Neck Surgery, Graduate School of Medicine, Chiba University, Chiba Japan 2Department of Functional Genomics, Graduate School of Medicine, Chiba University, Chiba, Japan 3Department of Urology, Graduate School of Medical and Dental Sciences, Kagoshima University, Kagoshima, Japan Background and Aims Top 10down-regulated miRNAs from TaqMan LDA in HSCC Top 10down-regulated miRNAs from TaqMan LDA in MSSCC miR-375 expression in 20 pairs of HNSCC samples miR-375 inhibited cancer cell proliferation and induced apoptosis MicroRNAs (miRNAs) constitute a class of small non-protein coding RNA molecules, 19 – 22 nucleotides in length. They negatively regulate multiple genes by mRNA cleavage or translational repression. Down-regulated miRNAs in cancer cells could function as a tumor suppressors by negatively regulating oncogenes. Our miRNA expression signatures of hypopharyngeal squamous cell carcinoma (HSCC), maxillary sinus squamous cell carcinoma (MSSCC) and esophageal squamous cell carcinoma (ESCC) revealed that microRNA-375 (miR-375) was significantly down-regulated in cancer tissues compared to normal epithelium. The aim of this study was to clarify the functional significance of miR-375 and to identify the gene targets miR-375 regulates in head and neck squamous cell carcinoma (HNSCC). P=0.008 SAS miR-375 expression (Normalized to RNU48) 1.6 * P<0.0001 1.4 100 2.5 * * 1.2 80 2.0 1.0 60 1.5 0.8 Early apoptosis cell (relative to mock) Cell proliferation (% of mock) 0.6 40 1.0 0.4 20 0.5 0.2 0 0 0 control control mock miR-375 mock miR-375 Normal Tumor Key Findings miR-375 directly regulates MTDH expression both in mRNA and protein levels Top 20 down-regulated genes by transfection of miR-375 in HNSCC cell lines Knocking down of MTDH inhibited cancer cell proliferation • 1. qRT-PCR revealed that miR-375 was down-regulated in HNSCC tissues compared with adjacent normal epithelium in 20 patients with HNSCC. • 2. Gain-of-function analysis revealed that cancer cell proliferation was inhibited and apoptosis was induced in miR-375 transfected HNSCC cells. • 3. Genome-wide molecular targets search and TargetScan database indicated that LDHB (lactate dehydrogenase B) and MTDH (metadherin) were candidate genes of miR-375target. • 4. qRT-PCR, Western blots, and luciferase assays revealed that miR-375 directly inhibits LDHB and MTDH expression. • LDHB, which is the glycolytic enzyme that catalyze the formation of lactic acid from pyruvate, promotes cell proliferation in HNSCC. • MTDH, which promotes tumorigenesis by modulating multiple signal transduction pathways such as NF- κB, PI3K/AKT, and Wnt pathway, promotes cell proliferation in HNSCC. SAS 120 MTDH(NM_178812) 3’UTR length:1637 * P<0.0001 100 miR-375 target site 1454-1460 80 * MTDH mRNA expression (% of mock) 60 * P<0.0001 40 SAS 5‘ ...ACUAGGAAAGCUAAACGAACAAA...              |||    ||||||| 3’     AGUGCGCUCGGCUUGCUUGUUU Position 1454-1460 of MTDH 3’UTR 20 100 0 5‘ ...ACUAGGAAAGCUAAA-------A...              |||    ||||||| 3’     AGUGCGCUCGGCUUGCUUGUUU 80 Position 1454-1460 deletion * * mock miR-375 control Cell proliferation (% of mock) 60 1.2 * P<0.0001 40 MTDH 1.0 20 β-Actin * 0.8 Luminescence (normalized) 120 0.6 0 100 0.4 80 0.2 60 MTDH normalized to β-Actin mock si-MTDH_1 si-MTDH_2 si-control 40 0 20 WT-3’UTR DEL-3’UTR 0 mock control miR-375 miR-375 directly regulates LDHB expression both in mRNA and protein levels The mRNA expression of candidate genes for miR-375 target in 20 pairs of HNSCC samples Knocking down of LDHB inhibited cancer cell proliferation HERPUD1 PSIP1 SLC7A11 LDHB(NM_002300) 3’UTR length:201 LDHB MTDH IMC-3 0.30 P=0.12 P=0.16 P=0.38 P=0.014 P=0.015 160 0.18 miR-375 target site 171-177 0.20 0.10 Conclusions 0.16 0.020 140 0.25 * P<0.0001 0.14 120 0.08 0.20 0.15 0.015 0.12 IMC-3 miR-375 functions as a tumor suppressor in HNSCC. LDHB and MTDH are directly regulated by miR-375. These genes may function as oncogenes and contributed to cell proliferation in HNSCC. Tumor suppressive miR-375 and its target oncogenes may provide new insights into the molecular networks of HNSCC. 100 LDHB mRNA expression (% of mock) Normalized to GAPDH Normalized to GAPDH Normalized to GAPDH Normalized to GAPDH 0.10 0.06 0.15 Normalized to GAPDH 80 0.010 0.10 0.08 5' ...GCAAUCUGAGCUCUU-GAACAAAU...             ||||     ||||||  3'     AGUGCGCUCGGCUUGCUUGUUU  Position 171-177 of LDHB 3' UTR 0.10 60 0.04 * P<0.0001 120 0.06 * 0.005 40 0.04 0.05 0.05 0.02 0.02 100 * * 20 0 0 5' ...GCAAUCUGAGCUCUU--------U...             ||||     ||||||  3'     AGUGCGCUCGGCUUGCUUGUUU  Position 171-177 deletion 0 0 0 0 Tumor Normal Tumor Normal Normal Tumor 80 Normal Tumor Normal Tumor mock miR-375 control Cell proliferation (% of mock) 60 * P<0.0001 References 1.2 LDHB 40 1.0 • Tumor suppressive microRNA-375 regulates oncogene AEG-1 /MTDH in head and neck squamous cell carcinoma (HNSCC) Journal of Human Genetics, 2011 56:595-601. • Tumor suppressive microRNA-375 regulates lactate dehydrogenase B in maxillary sinus squamous cell carcinoma International Journal of Oncology, 2012 40:185-93. GAPDH 0.8 20 Luminescence (normalized) 0.6 120 * 0 0.4 100 80 0.2 LDHB normalized to GAPDH mock si-control si-LDHB_1 si-LDHB_2 60 0 40 WT-3’UTR DEL-3’UTR 20 mock control miR-375 0

More Related