Investigation of RAP2 Transcription Factors and ABRE Mutations in Regulatory Functions
This study focuses on the transcription factors RAP2.4a, RAP2.6, and their interactions with various ABRE mutations to understand their roles in gene regulation. By analyzing DNA and protein sequences, we aim to elucidate the influence of specific mutations on the binding capacity and activity of these factors. The results may provide insights into the regulatory networks involved in plant development and stress responses. Our findings could have significant implications for improving stress tolerance in crops through genetic manipulation.
Investigation of RAP2 Transcription Factors and ABRE Mutations in Regulatory Functions
E N D
Presentation Transcript
Rap2.4a Rap2.6 Rap2.2 ERF4/Rap2.5 Rap2.3 Apetala2 Rap2.7 Rap2.8 Rap2.1 Rap2.10 CBF1 DREB2A A B -721 -673 -628 -616 -529 -511 -451 -438 -294 13 bp F1 (48 bp) - + + + DNA Protein F2 (105 bp) F3 (117 bp) F4 (90 bp) F5 (158 bp) RAP2.4a + 13 bp F1 F2 F3 F4 F5 free RAP2.4a DNA Protein - + + + - + + + - + + + - + + + - + + + C E RAP2.4a RAP2.6 D F4 MutA CE3 MutB MutC MutD MutE ABRE CE3: CTCCGGTCACGCGATTCAAC MutA:--------G----------- MutB:---------T---------- MutC:----------T--------- MutD:-----------T-------- MutE:------------T------- ABRE:******TACACGTGCA**** - + DNA - + - + - + - + - + - + shift