1 / 8

Novel Electrochemical Detection System for Potassium Ion and Glutamate in E. coli

This proposal presents a concept using induced pumps and channels for detecting and measuring changes in K+ ion and glutamate concentrations in E. coli. Steps involve chassis selection, creating potential differences, ligand detection, and measuring potential changes. Testing on mutant E. coli, over-expressing pumps, and introducing new channels is detailed. Further developments aim to amplify responses and detect multiple ligands.

bree-kemp
Télécharger la présentation

Novel Electrochemical Detection System for Potassium Ion and Glutamate in E. coli

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Biotricity Cambridge iGEM2008 Project Proposal

  2. Glutamate K+ K+ neutral relative to medium E.coli Concept Inducible pump K+ Constitutive channel +ve relative to medium E.coli

  3. Steps • Step 1 – Chassis selection • Step 2 – Setting up a potential difference between culture and external constant potential/ground • Step 3 – Detection of ligand and change in potential • Step 4 – Measurement of PD change

  4. Step 1 - Chassis Escherichia coli mutant: • Insensitive to glutamate • No Kch channels expressed Testing: • Glutamate on semi-solid agar plate • Immunoglobulin antibody precipitate test for Kch protein

  5. Step 2 - Setting up a PD Over-express Kdp (potassium pump): • Kdp operon native to E.coli • Adjust regulation Testing: • ELISA assay to measure Kdp protein production • Or measure K+ concentration/ PD • Or mass spectrometry, comparing peak intensities • Or 2D PAGE New

  6. Step 3 - Detection of ligand New Glutamate-gated K+ channel: • Already sequenced, from Granulobacter bethesdensis • Synthesise using • Transform into chassis Ttgacaccgtttttttctaacgctttcagacgccctctccgttctgtgtttaggctctgtttccttctgttctccatactggctcaggcaggcttgatgggagtcgtcctccctcctgcccatgctatggcagcggataaaaataccgccgagcatggtgtaatcaatgcaggctattttatcgatccgcctttcgtgctgccgcatcagaagaatgatcatccggccgggctggccattgatctatgggacaagacgtcacagatgcagggctggatcacccattatcaccgctatgaaacgatagccgatcttctctccgctcttgagcgcggggagatcgatgtcggtacggtcggcctgacaatcagcagccagcgtatggagaaagtgatcttcagccagccctggtttcagaccgggctgcggatgatgatcgtcaaacacaatagtaccggcctttccagacttctgagcgaactggctgcttccggccatctgcgtaactatttgttgatttttctggcgatcctggtggcga xxxxxxxxxxxxxxxcactgatcacagccatcatgcaccggcatgtgttgaaggattcatcaccccactggagttcctctctgtcgggcgccttc xxxxxxxxxxxxxxxxxxxxxxxtatgatatgatggcgatgctgaccggcaatcaaacgtccggcaccgtgccagagcgagccggtgcacg xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgatcattgccgccatctggctgctctgtggcgttggcattgtggcctatgtcacatccagcat xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtaccagcgtgatgacggcttcagaaatcaatcagcgcgtggacaatatcactg xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaactaggccatcgcccggtcagtgcgatgaaaggcagcatcgccatga xxxxxxxxxxxxxxxxxxxxxxxxcttttgccttggataccggcctgaacgttcacggatatacgctcctgtccgatgctgtagatgaactgatcc xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxagggcaaaacatccgccattctgggagatgcatcacagctcgattattatatccaacaga xxxxxxxxxxxxxxxxxxxxxxxxxaccccacccaatcactgatcgtaacaggcgctacactacgtccggaaaatctcggcttcgtcatgcggcccggtttccctatgcgttatcagatcgacaggaccattctcaagttgcaggaagaaaaaatcctgtcccagatggagtctgcctatttttcacatcgataa

  7. Step 4 - Measurement Look, Engineering! • Sensitive electrode in culture • Other electrode at known potential (could be ground)

  8. Further Developments 1) Amplify response: • Separate receptor and gated K+ channel • Connect via intracellular signalling pathway 2) Detect other or multiple ligands

More Related