Genomics
Harini Chandra. Genomics. The sum total of all genes of an individual organism is known as the genome and the study of the genome of an entire organism, which involves sequencing, genome mapping and data storage, is referred to as genomics. Master Layout (Part 1). 1. Template strand.
Genomics
E N D
Presentation Transcript
Harini Chandra Genomics The sum total of all genes of an individual organism is known as the genome and the study of the genome of an entire organism, which involves sequencing, genome mapping and data storage, is referred to as genomics.
Master Layout (Part 1) 1 Template strand This animation consists of 4 parts: Part 1 – Chain termination DNA sequencing Part 2 – Shotgun sequencing Part 3 – Next-generation sequencing techniques Part 4 – Genome sequencing projects 3’-----GAATTCGCTAATGC------- 5’ 5’-----CTTAA Primer 3’-----GAATTCGCTAATGC------- 5’ GCGATT A 5’-----CTTAA DNA Pol I dCTP, dATP, dGTP, dTTP 2 3’-----GAATTCGCTAATGC------- 5’ ddATP ddCTP GCGATTAC G ddTTP ddGTP 5’-----CTTAA 3 3’-----GAATTCGCTAATGC------- 5’ GCGATTA C 5’-----CTTAA Computer 4 3’-----GAATTCGCTAATGC------- 5’ Electrophoresis GCGA T 5’-----CTTAA Direction of migration Detector Laser 5 Source: Biochemistry by A.L.Lehninger, 4th edition (ebook)
Definitions of the components:Part 1 – Chain termination DNA sequencing 1 1. Template strand: The strand that is used as a template for synthesizing the new DNA strand is referred to as the template strand. The base sequence of the template strand is used to synthesize a complementary DNA strand. 2. Primer: A short stretch of nucleotides (usually RNA) which provides a free 3’ OH end to begin synthesis is referred to the primer. 3. Dideoxy nucleotides (ddNTPs): In the chain termination method, dideoxy nucleotides are added to the reaction system in addition to its other components. These nucleotide molecules contain a hydrogen atom at the 3’ position as opposed to the regular OH group present. Further chain elongation is stalled due to the presence of this hydrogen atom when a dideoxy nucleotide gets incorporated in the growing DNA strand. Each type of ddNTP is tagged with a unique fluorescent dye molecule that allows them to be easily detected. 4. Electrophoresis: A biochemical technique by which molecules of varying size can be separated within a gel matrix. In this technique, the synthesized DNA strands of varying lengths are denatured and then separated by gel electrophoresis. 5. Laser: The bands separated by electrophoresis are detected by scanning the gel with a laser beam. The unique fluorescent dye molecule attached to the terminating ddNTP allows each of the bands to be discreetly visualized and detected. 6. Detector: A suitable detector is used to detect the scanned images which are then stored on a computer. 2 3 4 5
Part 1, Step 1: 1 DNA Sequencing – Sanger’s dideoxy method 3’-----GAATTCGCTAATGC------- 5’ Dye-labelled ddNTPs ddATP GCGATT A 5’-----CTTAA 2 ddGTP 3’-----GAATTCGCTAATGC------- 5’ DNA Pol I dCTP, dATP, dGTP, dTTP GCGATTAC G 5’-----CTTAA Template strand 3’-----GAATTCGCTAATGC------- 5’ ddCTP 3’-----GAATTCGCTAATGC------- 5’ 3 5’-----CTTAA Primer GCGATTA C 5’-----CTTAA 3’-----GAATTCGCTAATGC------- 5’ ddTTP GCGA T 5’-----CTTAA 2’-3’ – dideoxy analog 4 Action Description of the action Audio Narration A simple and elegant method for DNA sequencing was devised by Frederick Sanger where a collection of DNA fragments are synthesized by means of controlled interruption of enzymatic replication. Four DNA synthesis reactions are carried out simultaneously with the strand whose sequence is to be determined being used as the template. The reaction mixture consists of regular deoxynucleotides and DNA Polymerase along with a small amount of one labelled dideoxy nucleotide analog being added to each of the four reaction mixtures. A primer is added to begin the DNA synthesis and strand elongation continues until a dideoxy analog gets added instead of the regular dNTP. Chain termination occurs at this stage due to the absence of a 3’ OH group for formation of the next phosphodiester bond. (Please redraw all figures.) First show the blue & red strands on the left with letters followed by the line with text ‘DNA Pol1, dCTP…’. Next the coloured label ‘ddATP’ must be shown on the arrow follwed by the blue & red boxes. The letters in the green box must appear one at a time. Once the ‘A’ in yellow appears, no more letters are added further. Similar sequence is depicted for all four reactions as depicted in animation. As shown in animation. 5 Source: Biochemistry by A.L.Lehninger, 4th edition (ebook)
Part 1, Step 2: 1 DNA Sequencing – Sanger’s dideoxy method Denature G G T T G G 2 A A A A Fragments of different lengths C C Electrophoresis 3 Computer Direction of migration Detector Laser 4 Action Description of the action Audio Narration (Please redraw all figures.) First show the paired strands on left top after which the arrow with ‘denature’ must appear and the strands must separate with only the ones with the colored circles remaining behind. These strands must then move into the grey tube with the label ‘electrophoresis’. Colored bands must then migrate from top to bottom of the grey tube as indicated. The cylinder marked ‘laser’ must then appear along with ‘detector’ and ‘computer’. A beam of light must then be emitted from the laser which on reaching the detector must lead to appearance of the signal on the computer screen. The synthesized strands are separated from each other, after which the differentially labelled strands of various lengths are separated by electrophoresis. The smallest fragments move further in the gel while the larger fragments remain close to the point of application. The different fluorescent labels of each ddNTP can then be detected by scanning the gel with a beam of laser. The output sequence obtained is complementary to the template strand, which can be used to deduce the original desired template sequence. As shown in animation. 5 Source: Biochemistry by A.L.Lehninger, 4th edition (ebook)
Master Layout (Part 2) 1 This animation consists of 4 parts: Part 1 – Chain termination DNA sequencing Part 2 – Shotgun sequencing Part 3 – Next-generation sequencing techniques Part 4 – Genome sequencing projects Genomic DNA BAC library 2 Organized contigs 3 BAC to be sequenced Shotgun clones 4 Shotgun sequence ...ACCGTAAATGGGCTGATCATGCTTAAA TGATCATGCTTAAACCCTGTGCATCCTACTG... Assembled sequence ...ACCGTAAATGGGCTGATCATGCTTAAACCCTGTGCATCCTACTG... 5 Source: Biochemistry by A.L.Lehninger, 4th edition (ebook)
Definitions of the components:Part 2 – Shotgun sequencing 1 1. Genomic DNA: The entire DNA sequence of all chromosomes of an organism constitutes its genomic DNA. There have been several projects aimed at deciphering the complete genome sequence of organisms including humans. 2. BAC library: Bacterial Artificial Chromosomes are DNA constructs that are useful for cloning purposes. These cloning vectors can carry DNA inserts of around 150-350 kbp and have been extremely useful in the various genome sequencing projects carried out. When an entire genome is fragmented and inserted into several of these vectors, it is known to be a library. 3. Contig: A set of overlapping DNA fragments that are obtained from a single genetic source. These contigs are used to deduce the original DNA sequence. 4. Shotgun clones: The BAC vector to be sequenced is selected and further fragmented into smaller strands for sequencing. These fragments are known as the shotgun clones. This is performed sequentially for each of the BAC vectors. 5. Shotgun sequence: All the fragments obtained are sequenced using Sanger’s chain termination method, after which they are assembled to obtain the complete genomic sequence. 6. Assembled sequence: DNA fragments that have been amplified using the BAC are sequenced to obtain the base pairs of each fragment. These are then used to deduce the original sequence of the intact DNA by aligning the fragments having overlapping end sequences. 2 3 4 5
Part 2, Step 1: 1 Shotgun sequencing Genomic DNA Restriction endonuclease 2 BAC library 3 Organized contigs 4 Action Description of the action Audio Narration (Please redraw all figures.) First show the violet figure on top. The green pie-shaped object must then move along this figure and cut it up into smaller pieces. These must then be straightened out and aligned next to each other. The red box must appear around one of the strands as shown. Genomic DNA is cleaved using a suitable restriction endonuclease and the fragments inserted into bacterial artificial chromosome vectors. These vectors enable the DNA fragments to be amplified. The genomic DNA fragments of the library are then organized into a physical map, after which individual clones are selected for sequencing. As shown in animation. 5 Source: Biochemistry by A.L.Lehninger, 4th edition (ebook)
Part 2, Step 2: 1 Shotgun sequencing BAC to be sequenced 2 Shotgun clones Sanger’s ddNTP sequencing 3 ...ACCGTAAATGGGCTGATCATGCTTAAA Shotgun sequence TGATCATGCTTAAACCCTGTGCATCCTACTG... Assembled sequence ...ACCGTAAATGGGCTGATCATGCTTAAACCCTGTGCATCCTACTG... 4 Action Description of the action Audio Narration The selected BAC is amplified and these clones are sequenced using the Sanger’s chain termination method. The sequence of the clone is then deduced by aligning them based on their overlapping regions. The entire genomic sequence is then obtained once each BAC is sequenced in this manner. As shown in animation. (Please redraw all figures.) Only the strand selected in the previous slide is then zoomed into after which it must be shown to multiply into several strands as shown. These must then be shown to be converted into sequences which are aligned and the overlapping part must be highlighted after which they must merge together to give a single complete sequence. 5 Source: Biochemistry by A.L.Lehninger, 4th edition (ebook)
Master Layout (Part 3) This animation consists of 4 parts: Part 1 – Chain termination DNA sequencing Part 2 – Shotgun sequencing Part 3 – Next-generation sequencing techniques Part 4 – Genome sequencing projects 1 CCD camera Pyrosequencing Luciferin Oxyluciferin PPi 2 Luciferase ATP sulfurylase DNA Pol AMP ATP T T T T T A G Primer Light Template DNA G G G G A A A A C A C T T T C 3 Event count Nanopore sequencing Exonuclease ssDNA Residual pore current 4 Nucleoside monophosphates (NMPs) Cyclodextrin Nanopore 5 Source: 1. Ronaghi, M. et al., A Sequencing Method Based on Real-time Pyrophosphate. Science 1998, 281(5375):363. 2. Clarke, J. et al., Continuous base identification for single-molecule nanopore DNA sequencing. Nat. Nanotech. 2009, 4: 265-270
Definitions of the components:Part 3 – Next-generation sequencing technologies 1 1. Pyrosequencing: A DNA sequencing strategy that makes use of the real time detection of pyrophosphate generated by the addition of a nucleotide to a growing DNA strand based on its corresponding DNA template. a. Template DNA: The DNA strand whose sequence is to be determined is used as the template for synthesis of a new complimentary strand of DNA. b. Primer: A short stretch of around 8-10 nucleotides that helps in initiating the process of synthesis of a new DNA strand by providing a free 3’ hydroxyl group for addition of nucleotides. c. DNA Polymerase: The enzyme used for the synthesis of DNA which adds nucleotides to the free 3’OH group of another nucleotide based on the sequence of the complimentary template DNA. d. ATP Sulfurylase: Enzyme involved in conversion of pyrophosphate to ATP. e. Luciferin: One of the substrates used for reaction with the enzyme luciferase along with ATP to generate light. f. Luciferase: The enzyme that catalyzes the reaction between luciferin and ATP to generate light along with their respective products, oxyluciferin and AMP. The light produced by the firefly insects is due to this luciferase-catalyzed reaction. g. CCD camera: A charge-coupled device camera that is capable of capturing any changes in production of light during the reaction. 2 3 4 5
Definitions of the components:Part 3 – Next-generation sequencing technologies 1 2. Nanopore sequencing: This is a single-molecule DNA sequencing technology that does not require any fluorescent labeling and makes use of any changes in electrical current produced when single nucleotides pass through the nanopore. a. ssDNA: Single stranded DNA whose sequence is to be determined. b.Exonuclease: Exonucleases are enzymes that cleave DNA, one nucleotide at a time, starting from the end rather than cleavage at internal sites. c. Nucleoside monophosphates (NMPs): These are the nucleotide molecules attached to a single phosphate residue released upon cleavage of the ssDNA with the exonuclease. These NMPs are subsequently detected upon passing through the nanopore. d. Nanopore: A nanopore consists of a protein pore under an applied potential which records modulations in ionic current that are generated when molecules pass through the pore. Authors made use of hemolysin mutant as the nanopore. e. Cyclodextrin: The protein pore is covalently linked to an adapter molecule, cyclodextrin, which enables continuous detection of nucleotide base. Position of the adapter molecule was optimized to enhance base discrimination at high acquisation rates. f. Residual current: Current present in the nanopore after passing of each molecule through the pore. g. Event count: The number of times a particular nucleotide base is detected on passing through the nanopore. 2 3 4 5
Part 3, Step 1: 1 Light liberated from luciferase reaction is proportional to the nucleotides added. Multiple rounds of DNA sequencing in this manner enable determination of the template sequence. CCD camera Apyrase Pyrosequencing Round 1 Round 2 ATP sulfurylase 2 Luciferin Oxyluciferin PPi PPi Luciferase AMP ATP G T C C C T T T 3 A DNA Pol A G G C A A T T C A G G A T C Primer Immobilized Template DNA 4 Action Description of the action Audio Narration First show the ‘template DNA’, ‘primer’ & ‘DNA Pol’. Next show the green ‘T’ shapes coming of which one must enter the groove above the ‘A’ as shown. The green ’PPi’ must be released when this happens after which ‘ATP sulfurylase’ must appear. The ‘PPi’ must disappear and ‘ATP’ must appear. Next, ‘luciferin’ & ‘luciferase’ must appear which results in appearance of ‘AMP’ &’oxyluciferin’& disappearance of ‘luciferin’ & ‘ATP’ & appearance of light which must be directed towards a camera placed above. Next, the ‘apyrase’ must appear which must wipe out remaining ‘T’ shapes along with disappearance of ‘AMP’, ‘Oxyluciferin’ & light. Next ‘C’ shapes must enter & similar sequence of events must be carried out as shown in animation. As shown in animation. Multiple round of nucleotide addition are carried out on the immobilized template DNA using DNA Polymerase in the presence of ATP sulfurylase, luciferase and the nucleotide degrading enzyme apyrase. The release of an equal amount of pyrophosphate is determined by its conversion to ATP by ATP sulfurylase which in turn is determined by the release of light on reaction with luciferase. The amount of light produced is determined by means of a CCD camera which is used to determined the nucleotide added & therefore the sequence of the template DNA 5 Source: Ronaghi, M. et al., A Sequencing Method Based on Real-time Pyrophosphate. Science 1998, 281(5375):363.
Part 3, Step 2: 1 Nanopore sequencing Event count C C T A A 2 G Residual pore current G ssDNA C Exonuclease A G T T T A T A A C C G 3 Nanopore Cyclodextrin Nucleoside monophosphates (NMPs) 4 Action Audio Narration Description of the action This innovative method offers a label-free approach for DNA sequencing. An exonuclease cleaves the single stranded DNA, one base at a time to release the nucleoside monophosphates. These NMPs pass through the nanopore under an applied potential, which is covalently coupled to an adapter molecule. Continuous movement of NMPs through the nanopore results in characteristic fluctuation of electric current which enables detection of the various nucleotide bases. As shown in animation. First show the structure below with all components labeled. This is followed by appearance of ‘ssDNA’ strands. The violet rings must then move across this strands, one circle at a time. As it keeps moving, the circles must be removed and must pass through the ‘nanopore’ one at a time. The rate of movement of the violet ring must be faster than the movement of circles through the pore which must therefore accumulate outside the pore before entering it. Every time a circle passes through the pore, the peak of the corresponding color must increase in the graph. 5 Source: Clarke, J. et al., Continuous base identification for single-molecule nanopore DNA sequencing. Nat. Nanotech. 2009, 4: 265-270
Master Layout (Part 4) 1 This animation consists of 4 parts: Part 1 – Chain termination DNA sequencing Part 2 – Shotgun sequencing Part 3 – Next-generation sequencing techniques Part 4 – Genome sequencing projects 2 Bacterial genome sequencing S. cerevisiae sequencing 3 1990 1992 1993 1994 1995 1996 1997 1998 1999 2000 2001 1991 D. melanogaster sequencing A. thalina sequencing Mouse genome sequencing Human genome sequencing 4 5
Definitions of the components:Part 4 – Genome sequencing projects 1 1. Genome sequencing projects: These are scientific endeavours that aim to elucidate the complete genome sequence of all chromosomes of an organism. Several such projects have been undertaken and successfully completed by various research groups all over the world. While deciphering the sequence might be a relatively easy task for simpler organisms such as bacteria, sequencing the genome of higher organisms has proved to be a challenge. However, researchers have come together in their effort and this resulted in successful completion of the human genome sequence in 2003. 2 3 4 5
Part 4, Step 1: 1 Genome sequencing projects International Nucleotide Sequence Database Collaboration 2 3 Insects Bacteria Fungi Plants Humans Mouse Yeast 4 Action Description of the action Audio Narration Several genome sequencing projects that aim to elucidate the complete genome sequence of organisms have been undertaken by several research groups all over the world. The DNA sequences are identified by the shotgun sequencing technique and then aligned using suitable software to provide the complete genome sequence. The genome sequence of a large number of prokaryotic and eukaryotic organisms have been successfully deduced. As shown in animation. First show the DNA structure below which must be in the background. Next, the names of the organisms must appear sequentially as shown after which the red arrow must appear which must point to the computer screen having the text as shown. 5
Part 4, Step 2: 1 6 Countries 2 Human genome project 3 1990 - 2003 20 Labs 4 Action Audio Narration Description of the action As shown in animation. The immense amount of information held by the human genome motivated researchers to understand the nature and content of genetic material in great detail. A collaborative effort between 6 countries and 20 laboratories was undertaken in 1990 to produce a draft of the human genome sequence. Work proceeded rapidly with a draft covering most of the genome being completed by 2000 and greater coverage being achieved by 2003. First show the appearance of the ‘6 countries’ , ‘20 labs’ text followed by each of the flags sequentially. Next, the ‘human genome project’ must appear as shown followed by the years below. 5
Part 4, Step 3: 1 Human genome project 23 pairs of human chromosomes mapped Main aim of HGP – To read, letter-by-letter, the 3 billion bases of the human DNA! 2 3 4 Action Description of the action Audio Narration As shown in animation. Before sequencing the entire genome, physical maps of the chromosomes were made. This helped in providing key tools for identification of disease genes and anchoring points in the genomic sequence. Pilot projects were then launched to create a draft of the genome sequence. Doubts regarding the potential of available sequencing techniques were overcome in this phase when it was established that they could sequence the genome efficiently. First show the text on top left followed by the graph on the right along with the image. This is followed by appearance of the red circular regions. 5
Part 4, Step 4: 1 Human genome project Human DNA # of bases identified (thousands) 2 3,000,000 Shotgun sequencing 2,000,000 TATATGCCTTTAAGGATTTGCA CGGAATCCCGGATGCCTATAT AATCCCGGAATCCCGGATGCC CGGAATCCCGGATGCCTATAT AATCCCGGAATCTGCCTATAT TATATGCCTTTTCCCGGATGCC CCCGGATGCCTATATGCCTTT AATCCCGGAATATGCCTATAT 3 1,000,000 1997 1996 1998 2000 2001 1999 Year 4 Action Description of the action Audio Narration As shown in animation. The shotgun approach was the fundamental technique used for large scale sequencing of the human genome, which also makes use of Sanger’s sequencing. The collaborative effort to sequence the entire genome was challenged in 1998 by a privately funded organization which aimed to reach the target before the publicly funded group. Progress made in sequencing was very rapid and by 2001, a draft of the sequence was ready covering around 83% of the genome. First show the ‘human DNA’ figure on top followed by the arrow with the text on it. Next the sequences shown must scroll from bottom to top continuously without stopping. Simultaneously, the graph on the right must appear gradually. 5
Part 4, Step 5: 1 Human genome project IMPORTANT FINDINGS MAJOR OBSTACLES There are about 30,000 protein coding genes in the human genome. Presence of large regions of repeat sequences such as centromeres and telomeres. 2 Hundreds of human genes may have resulted from horizontal transfer from bacteria. Difficulty in sequencing multigene families by shotgun method. Mutation rates in males are twice as high as in females. 3 Recombination rates tend to be higher in distal regions of the chromosome. Large stretches of non-coding sequences making it difficult to identify protein-coding genes. There have been more than 1.4 million single nucleotide polymorphisms identified on the human genome. 4 Action Description of the action Audio Narration As shown in animation. Several hurdles were encountered during sequencing of the human genome, the largest of them being the presence of long stretches of repeating sequences. These repeat regions made it difficult to assemble to genome accurately and the improved drafts published in 2003 covered 92% of the genome with a large part of the remaining 8% being due to the repeat sequences. Nevertheless, these genome sequencing studies successfully provided many findings about the human genome. (Please redraw all figures.) First show the column on the left with the image in the background. Next, the three points must appear sequentially. Then show the heading on the right followed by each of the points appearing under this column. 5
Interactivity option 1:Step No:1 1 A genomic DNA sequence was cut into 5 fragments using a suitable restriction endonuclease. After amplification in the BAC, sequencing of these fragments gave the following sequences: 1. ATTTGCAAATCCCGGAAT 2. GCCTTTAAGGATTTG 3. GGAATCCCGGATGCCTATAT 4. CGGGCGTTATGGCTTAC 5. TATATGGCCCAATACGCGGGC What is the sequence of the intact original DNA? 2 A) GCCTTTAAGGATTTGCAAATCCCGGAATCCCGGATGCCTATATGGCCCAATACGCGGG CGTTATGGCTTAC B) ATTTGCAAATCCCGGAATGCCTTTAAGGATTTGGGAATCCCGGATGCCTATATCGGGCGTTAT GGCTTACTATATGGCCCAATACGCGGGC 3 C) GCCTTTAAGGATTTGCAAATCCCGGAATTATATGGCCCAATACGCGGGCGTTATGGCTTACGG AATCCCGGATGCCTATAT D) GCCTTTAAGGATTTGCAAATCCCGGAATGGCCCAATACGCGGGCGTTATGGCTTACCCC GGATGCCTATAT 4 Results Interacativity Type Options Boundary/limits User should be allowed to choose one of the four options but can continue to choose until he arrives at the right answer. The correct answer (A) must turn green if chosen while remaining must turn red if selected. User should be directed to next slide, step 2, upon choosing correct answer. Choose the correct option. 5
Interactivity option 1:Step No:2 1 By analyzing the end sequence overlaps and aligning the fragments, the entire original DNA sequence can be deduced. GCCTTTAAGGATTTG ATTTGCAAATCCCGGAAT 2 GGAATCCCGGATGCCTATAT TATATGGCCCAATACGCGGGC CGGGCGTTA-TGGCTTAC 3 GCCTTTAAGGATTTGCAAATCCCGGAATCCCGGATGCCTATATGGCCCAATACGCGGG CGTTATGGCTTAC 4 5
Questionnaire 1 1. Which of the following enzymes in the pyrosequencing technique is responsible for conversion of pyrophosphate to ATP? Answers: a) Apyrase b) DNA Polymerase c) ATP Sulfurylase d) Luciferase 2. The nanopore sequencing technique makes use of which of the following parameters to identify the liberated NMP molecules? Answers: a) Wavelengthb) Pore current c) Surface structure d)Kinetic energy 3. Which of the following vectors is used in the shotgun sequencing approach? Answers:a) BAC b) Phage particles c) pBR322 d) None of the above 4. Which of the following terms refers to ‘a set of overlapping DNA fragments that are obtained from a single genetic source’? Answers:a) BAC library b) Shotgun clone c) Contig d) Vectors 2 3 4 5
Links for further reading Books: Biochemistry by A.L.Lehninger et al., 4th edition Research papers: • Sanger, F. et al. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 1977, 74 (12): 5463-5467. • Maxam, A.M. & Gilbert, W.A new method for sequencing DNA. Proc. Natl. Acad. Sci.USA 1977, 74: 560–564. • Ronaghi, M. et al., A Sequencing Method Based on Real-time Pyrophosphate. Science 1998, 281(5375):363. • Clarke, J. et al., Continuous base identification for single-molecule nanopore DNA sequencing. Nat. Nanotech. 2009, 4: 265-270 • Lander, E. S. et al. Initial sequencing and analysis of the human genome. Nature 2001, 409 (6822): 860-921. • Venter, J. C. et al. The Sequence of the Human Genome. Science 2001, 291:1304-1351.
Links for further reading Research papers: • Margulies, M. et al., Genome Sequencing in Open Microfabricated High Density Picoliter Reactors. Nature 2005, 437 (7057): 376-380. • Stephan C Schuster, Next-generation sequencing transforms today’s biology. Nat. Methods 2008, 5 (1): 16-18. Links: www.genome.gov