bud
Uploaded by
50 SLIDES
689 VUES
500LIKES

GENETICS

DESCRIPTION

GENETICS. 1. What is Genetics?. The Study of similarities and differences between relatives. What is it that elephants have that no other animal has?. What is Genetics?. The study of similarities and differences between relatives. What is it that elephants have that no other

1 / 50

Télécharger la présentation

GENETICS

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. GENETICS 1

  2. What is Genetics? The Study of similarities and differences between relatives. What is it that elephants have that no other animal has?

  3. What is Genetics? The study of similarities and differences between relatives. What is it that elephants have that no other animal has? BabyElephants!

  4. Why do we resemble our parents? • Our parents provided most of the information (in the sex cells) that governs our appearance, our activity, and our behavior. • They provided most of the GENES. • Genetics is also seen as the study of Genes or genetic variation. 4

  5. Genetics Attempts to Answer These Questions: • 1. How are Genes Transmitted? • 2. What are Genes? • 3. How are Genes (the genetic material) organized to function efficiently? • 4. What kind of activities do Genes control? • 5. How do Genes control these activities to produce the differences we see? 5

  6. Early ideas about inheritance Archeological evidence from 8,000 – 1,000 B.C. shows horses, camels, and oxen had been domesticated and that various breeds of dogs had derived from wolves, through artificial selection. 6

  7. Early ideas about inheritance • Cultivation of many plants, including wheat, corn and rice as well as the date palm began as early as 5,000 B.C. • The appearance of new varieties from unconscious attempts to breed and cultivate must surely have led in time to conscious attempts to propagate desirable traits and the elimination of undesirable traits by the breeders. wheat corn corn Rice 7

  8. Early ideas about inheritance • The Assyrians were sophisticated and experienced breeders of domesticated plants and animals and had artificially pollinated date palms (shown at right) by 800 B.C. 8

  9. Simple rule of heredity… • These early practitioners seemed to work from the simple rule of heredity; like breeds like; … and sometimes unlike! • Select breeds with the desirable characteristics and breed them! 9

  10. The Greek Influence on ideas of inheritance • Hippocrates – “Humors”, which could be altered during an individuals lifetime and therefore diseased or normal, were drawn from various parts of the body to the semen and passed on to the offspring. This “pangenesis” theory even formed the basis of Darwin’s early ideas of inheritance. • Aristotle – semen produced a “vital heat” that cooked and shaped the menstrual blood giving it the capacity to produce offspring with the same “form” as the parent. 10

  11. Later ideas of inheritance (1600- 1850) Pre-formationism – sex cells contain a complete miniature adult (the homunculus)  Epigenesis – presumably put forth by Harvey, held that body structures were not present in the sex cells, but were formed anew. 11

  12. Other ideas of inheritance • Pangenesis – the inheritance of acquired characteristics – put forward again by Jean Baptiste Lamarck. [the notion was discredited by August Weissman, who cut tails off mice for 22 generations and continued to get mice with long tails] • Blending Inheritance – the belief that characteristics of parents blended like paint, e.g., mix blue and yellow and get green paint. 12

  13. Gregor Mendel • Seven years after Darwin published his theory, Mendel, an Austrian monk, published (in 1866) his findings on inheritance in peas. Mendel discovered the rules governing “vertical” gene transmission. Gregor Mendel 13

  14. Mendel’s Discoveries (2 laws) • Mendel’s 1st Law - The Law of Segregation (essentially has 4 parts) • 1. Alternative versions of “genes” account for variations in inherited characters. In a simple case, shown here are 2 versions of a “gene”. Where the flower of the pea plant is yellow (due to gene y) or purple (due to gene Y). Many genes have hundreds of alternatives, and might be expressed thus: Y1, or Y2, or Y3, or Y4, orY5, etc. 14

  15. Mendel’s 1st law (parts 2 and 3) • 2. For each character, an organism inherits 2 “genes”, one from each parent. • 3. If the 2 “genes” differ, then one, the dominant “gene”, is expressed and the other, the recessive “gene” has no noticeable effect on the organism’s appearance. 15

  16. Mendel’s 1st law (part 4) • 4. The 2 “genes” then separate again when the organisms forms sex cells (gametes), each sex cell receiving only 1 of the 2 possible “genes”. 16

  17. Mendel’s Discoveries (the 2nd law) • Law of Independent Assortment. • The most important principle of this law is that the emergence of one trait (e.g., plant height) will not effect the emergence of another (e.g., flower color) 17

  18. New Offspring = New gene combinations • Built into the mechanism for gene transmission is a means for creating variability. Reshuffling of genes in the sex cells of the parents creates new combinations of genes in the offspring. • Totally new genes can be created by Mutation. 18

  19. Highlights of some discoveries following Mendel’s work • 1900 - Mendel’s work was rediscovered. • 1902 - Sutton proposed that genes were located on chromosomes. • 1944 - The genetic material was found to be DNA. • 1953 - Watson and Crick propose a model for the structure of DNA that also suggests a means for its faithful replication. • 1966 - How DNA worked to control the activities of the cell had all been worked out [ DNA  RNA  protein] 19

  20. Highlights of some discoveries following Mendel’s work (cont.) • 1973 – Recombinant DNA molecules formed. • 1977 – Sequencing of DNA achieved. • 1983 – PCR technique developed. • 1990 – First successful gene therapy. • 1995 – The Human Genome Project (HGP) gets underway. • 2003 – HGP essentially completed. 20

  21. Vertical Gene Transmission • While most of our genes come from our parents (vertical transmission) – some may not have!!! • Some of it is coming in horizontally. It seems that some of our genetic material is coming from viruses and other parasites that invade us. 21

  22. Horizontal Gene Transmission • The Human Genome Project (HGP) has found that there is a lot of the DNA of our genes that is identical to that of viruses. • These parasites have the ability to introduce some of their genetic material into their host’s (meaning us) genetic material. 22

  23. Horizontal Gene Transmission (HGT) • These viruses have apparently been doing this for millions of years. • These viral elements make up 45% of our DNA and fully 8% of that comes from retroviruses. HIV is a retrovirus. 23

  24. Horizontal Gene Transmission (HGT) • What are these viral genetic elements doing in our DNA? Are they having any effect? • The answer appears to be that they are having an effect….the complete answer remains to be discovered when more research is done. 24

  25. What are Genes? • Genes consist of a polynucleotide chain called DNA (or RNA for some viruses) that generally exists as a double helix. 25

  26. What are Genes? • The nitrogen bases, here represented with the letters: A, T, G, and C, signify a code that is translated into one of the 20 amino acids that make up every protein found in every organism on earth. 26

  27. What are Genes? • Each nitrogen base always pairs with another base such that A always pairs with T and G with C. There are 3,200,000,000 base pairs in each human cell, a string that would stretch 1 meter (ca. 3 feet) in length. 27

  28. What are Genes? • A gene is a string of nitrogen bases that dictates the manner by which Proteins are made….nothing more….nothing less. • Proteins are made up of strings of amino acids. They function as enzymes (organic catalysts) and as structural building blocks of the cell. • A gene, then, is a recipe for making a protein. 28

  29. How much DNA (or genes) do cells have? Species Genes DNA (bp) E. coli (bacterium) 4,400 4,600,000 Yeast cell 6,000 12,000,000 Roundworm 19,000 97,000,000 Fruit fly 13,600 165,000,000 Rice plant 55,000 466,000,000 Gallus gallus (Chicken) 23,000 1,000,000,000 Rat 30,000 2,750,000,000 Homo sapiens (human)25,000 3,200,000,000 Amoeba proteus (amoeba) ? 290,000,000,000 29

  30. How much DNA (or genes) do HUMAN cells need? • First of all, if we assume 25,000 genes in the human, and use a figure of 3,000 bp per gene then we need only 75 million bp for all our genes. We have about 3.2 billion base pairs in our DNA!! • This means we can account for all our genes with only 2% of the DNA in our cells. • The rest is referred to as “Junk” or repetitive DNA. 30

  31. How is all this genetic material organized to function efficiently? • In diploid organisms like ourselves, the DNA is organized into chromosomes. 31

  32. What kinds of activities do genes control? • Virtually every type of activity a cell or organism engages in is controlled by genes…through the formation of proteins. • There are 2 major types of proteins: 1. Structural – involved in building and maintaining subcellular structures. 2. Functional – enzymes. 32

  33. How do genes control activities? • Since proteins control essentially all the activities of a cell, if the cell knows how to make all the proteins….it doesn’t need to do anything else. • Enzymes carry out all the reactions in a cell. • Structural proteins combine with other proteins, carbohydrates and lipids by a process known as “self-assembly” to form all the sub-cellular structures within the cell. 33

  34. We know exactly how the cell does this DNA in the nucleus of the cell makes a nearly identical copy of itself and transports this copy to the site of protein synthesis in the cell. Using the genetic code, the message originally present in the DNA and transcribed into the RNA copy is translated into a protein. This process takes only seconds to accomplish since it is aided by enzymes. 34

  35. Cells translate the message in the genetic code to create proteins. • The 4 bases in the DNA are a recipe for adding amino acids one by one to make a protein, and 61 of the 64 possible ways of arranging these 4 bases in 3-letter words proscribes an amino acid. The remaining 3 order a STOP to the process….the protein is done. 35

  36. We differ from our parents because the proteins coded from DNA are different! • Individuals differ from one another in the specific sequence of bases in their DNA. 1…TAGGCTGGCATTATATGCGAATTG… …ATCCGACCGTAATATACGCTTAAC… 2…TAGGCTGGCGTTATATGCGAATTG… …ATCCGACCGCAATATACGCTTAAC… 36

  37. Changes in DNA ultimately result in changes in the amino acid (message) • …TAGGCTGGCATTATATGCGAATTG… … THE CAT SAW THE RAT … …..…TAGGCTGGCGTTATATGCGAATTG… • … THE CAT ATE THE RAT … 37

  38. The HUMAN GENOME PROJECT We have just completed sequencing the entire human genome and there are exactly 3.164 billion base pairs in the human genome. The best estimate is that there are only 25,000 genes, half of which we don’t yet know the function. The rest consists of highly repetitive sequences (e.g., TTTGGCTTTGGCTTTGGC) repeated over and over thousands of times. 38

  39. The HUMAN GENOME PROJECT Almost 99.9% of the base pairs are exactly the same in all people! (This still leaves about 3 million base pairs that differ among any two individuals) Focus on the similarities… The genome is full of non-coding or “Junk” or repetitive DNA – but even this can be useful for DNA Fingerprinting. 39

  40. DNA Fingerprinting Can help to convict the guilty and exonerate the innocent. In a famous case in England, a rapist was caught 3 yrs after the crime when DNA from the sperm was matched with his DNA. 40

  41. What can we do with all that we have learned about genes? The first organism to have its genetic material completely sequenced was a bacterial virus (ΦX174). It has 5,386 base pairs. Using this information, researchers 2 years ago synthesized a completely artificial virus from lab chemicals that was 100% identical to the natural ΦX174 virus; and it was able to behave like the natural virus – infecting a bacterial cell. We have created life in a test tube… or at least…..duplicated it! 41

  42. What else can we do with what we have learned about genes? We can isolate individual genes from any organism or individual. We can make millions of copies of that gene in a matter of hours. We can combine that gene with others in what is called a Recombinant DNA molecule and insert that into most any organism we choose. This is called Genetic Engineering 42

  43. Genetic Engineering Human insulin produced in a bacterium using a gene obtained from humans. Bacterium full of insulin 43

  44. Gene Therapy • The technology may eventually be used to treat a whole range of inherited disorders… • …for example, why not introduce the gene for insulin production into insulin-dependent diabetics rather than having them rely on frequent insulin injections? 44

  45. Gene Therapy (cont.) SCID (severe combined immunodeficiency disease) is a fatal condition due to the absence of an enzyme, adenine deaminase or ADA. • Individuals with this disease lack a functional immune system. They must be kept in a sterile environment. They were often referred to as “bubble babies”. 45

  46. Gene Therapy (cont.) The gene for ADA has been isolated, combined with a harmless virus (Recombinant DNA) and introduced into children with this condition. The photo on the right shows one successful application of this technology. 46

  47. Gene Therapy (cont.) • Of course, every new technology has its downside… Performance-enhancing drug use has become a big problem in both professional and amateur athletics. Periodic testing for these drugs probably reduces their use somewhat. 47

  48. Gene Therapy (cont.) What if athletes began to use “gene doping”, where genes for Human Growth Hormone (HGH) or Insulin-like Growth factor (IGF-1) would be introduced into their muscles? It would be more effective and essentially non-detectable. Olympic officials are definitely worried about this happening – fearing it has the potential to ruin athletic competition as we know it. 48

  49. Gene Engineering A gene for insect resistance (Bt) has been engineered into most all of the corn we consume, rendering it quite resistant to the European corn borer. Many other fruits and vegetables have been engineered for drought and cold resistance and resistance to plant diseases. 49

  50. GENETICS • The End

More Related