Kath Crawford Jan Barfoot

1. PCR of Chloroplast DNA Kath Crawford Jan Barfoot

2. Today’s activities • Amplification of chloroplast DNA • Photosynthesis – an overview • Bacterial transformation with the pGLO plasmid

3. Schedule for today • Plant PCR: Extraction of DNA from plant material Photosynthesis – an overview (lecture theatre) • Plant PCR: Purification of DNA from plant material Amplificationof cpDNA Bacterial transformation using pGLO (lab) • Plant PCR: Gel electrophoresis of amplified products Explanation and discussion Stain and record results

4. Plant PCR The use of amplified chloroplast DNA (cpDNA) to investigate evolutionary relationships of common plants

5. Plant PCR (i) Extraction of DNA from plant material (p8) FTA card – chemically treated paper matrix for the safe collection, transport, storage, purification and analysis of DNA. DNA is extracted on to the paper matrix, purified and then amplified.

6. Plant PCR • One FTA card • One backing board • Four different plant materials (2 Brassicas, 2 non-Brassicas) • Four pestles • One punch per 8 people

7. Plant PCR Place backing board between the back cover of the card and the absorbent layer.

8. Plant PCR Place a piece of fresh plant material on to one box on the FTA card. Ensure it does not extend outwith the box. Close cover.

9. Try to keep the sample within the box. Plant PCR Using a pestle, squash the leaf on to the card until moisture has soaked through to the back of the absorbent layer. Discard squashed plant material.

10. Plant PCR Repeat extraction for second plant material in a different box. Try to ensure no ‘escape’ to another box!

11. Plant PCR Make sure that moisture from the leaf has soaked through to the back of the paper.

12. Plant PCR Repeat extraction for third and fourth plant materials in the remaining boxes. Try to ensure no ‘escape’ of extracted materials to other boxes!

13. Plant PCR Have you labelled your samples?

14. Plant PCR Leave cards open to dry. Transfer to lecture theatre.

15. Plant PCR (ii) Purification of the extracted DNA (p9) • Use the punch in turn (cleaning between samples) so that each person removes one disc – the DNA to be amplified is on the disc. • One Brassica and one non-Brassica per pair. • One of each sample or one of three samples + negative control (blank paper, one per card) per four people. One completed card (four samples), one punch per 8 people

16. Plant PCR 1. Place cutting/backing board (clean!) behind absorbent layer. Place tip of the punch over the area to be sampled, press firmly and rotate to remove a paper disc. Important – choose an area where the extract has soaked through to the back. Clean punch between samples by removing a disc of paper from an extract-free area.

17. Plant PCR 2. Use a cocktail stick to transfer the disc from the punch into a labelled, clear 1.5 cm3 microcentrifuge tube. Use a different cocktail stick for each sample!

18. Plant PCR Micropipettes • One P-20 (2 – 20 l) • One P-200 (20 – 200 l) per 2 people

19. Plant PCR • Twist dial to desired volume • Pick up pipette tip • Press plunger to first, soft stop • Insert pipette tip into solution to be transferred • Slowly release plunger to retrieve liquid • Move pipette tip to above desired well • Press plunger past first stop to second, hard stop to transfer liquid

20. Plant PCR 3. Use a P-200 micropipette to add 150 l Purification reagent to the disc. Different tips for different discs! 4. Close tube and flick tube to wash the disc. Ensure the disc remains in the liquid. 5. Remove and discard purification reagent. 6. Repeat steps 3,4 and 5

21. Plant PCR 7. Use a fresh tip to add 150 l TE-1 buffer to the disc. Different tips for different discs! 8. Close tube and flick tube to wash the disc. Ensure the disc remains in the liquid. 9. Remove and discard buffer. 10. Repeat steps 7, 8 and 9

22. Plant PCR (iii) Amplification of cpDNA (p10) 1. Label PCR tube PCR beads contain Taq polymerase, dNTPs, buffers, co-factors • 2 - 4. Add reagents • 4 l sterile deionised water • 10 l CHc primer (yellow) • 10 l CHd primer (blue)

23. Plant PCR 5, 6 Flick bottom of PCR tube – centrifuge if necessary. 7. Use a clean cocktail stick to transfer the disc from microtube to PCR tube. Ensure disc is submerged in the PCR reagents.

24. Plant PCR 8. Place in thermal cycler. Carry out pGLO transformation practical and then have lunch while DNA is amplifying.

25. Diagram: Dean Madden NCBE Plant PCR (iv) Gel electrophoresis of PCR products (p 10) – One gel tank per pair 1. Use a P-20 micropipette to add 2 l loading dye to 8 l DNA ladder (lilac microtube). Mix and load all 10 l into well 1 in a 1.5% agarose gel.

26. Plant PCR 2. Using a fresh tip, add 2 l loading dye to your amplified sample and mix. 3. Load 10 l of the sampleinto a different well in the gel. Note sample/well! 4. Repeat step 3 for other PCR samples. Each gel tank should contain a ladder, two Brassicas, two non-Brassicas and one other or a negative control.

27. Diagram: Dean Madden NCBE Plant PCR

28. Plant PCR

29. Plant PCR -extraction Traditional method • Mechanical breakdown of cell walls/membranes by homogenisation with sand • Chemical disruption of cellular membranes by addition of detergent (SDS) • EDTA chelates Mg++ ions, helps break up protein complexes • NaCl helps disrupt cells and precipitate DNA • Tris buffer maintains appropriate pH • Ethanol to precipitate DNA

30. Plant PCR -extraction FTA Cards – technology for processing nucleic acids invented by Professor Leigh Burgoyne of Flinders University • Flinders Technology Australia, Fast Track Analysis • Commercially obtained from Whatmans –contain SDS, TrisEDTA buffer and other proprietary reagents • Application in research, diagnostics, environmental science, forensics and DNA databases • Included in SAPS/NCBE PCR kit

31. Plant PCR -extraction Purification buffer • Commercial preparation, composition unknown but possibly contains SDS, Tris EDTA buffer • Removes naturally occurring agents that would inhibit the PCR. For example, compounds that contain heavy metals such as chlorophyll, and other proteins. TE-1 buffer (10 mM TrisHCl,0.1 mM Na2EDTA pH 8) • Removes SDS • Ensures correct pH

32. Plant PCR Polymerase Chain Reaction (PCR) • Allows selective amplification of any fragment of DNA providing the nucleotide sequences flanking the fragment are known Finds a needle in the haystack and then produces a haystack of needles by selective amplification • Kerry Mullis: Nobel Prize 1993

33. (1) Denaturation – by heating to 94°C - 98 ° C Plant PCR Three stages in PCR

34. Three stages in PCR • (2) Annealing – of synthetic oligonucleotide primers to end of area to be copied at 64 ° C primers Taq polymerase Plant PCR Three stages in PCR

35. Plant PCR Three stages in PCR • (3) Extension – of the strand by DNA polymerase from Thermus aquaticus at 72°C These three steps are repeated many times, the quantity of DNA doubling with each cycle

36. Plant PCR -amplification PCR Beads: each bead is designed for a single 25 l reaction, in which volume the final component concentrations are: • Taq polymerase ~2.5 units • dNTPs (dATP, dCTP, dGTP, dTTP) 0.2 mM each • TrisHCl (pH 9.0) 10 mM • KCl 50 mM • MgCl2 1.5 mM PCR Primers Primers are diluted to a working concentration of 10 pmol/ l • CHc primer (forward) • CHd primer (reverse)

37. Cycle 1 Cycle 2 Cycle 3 5| 3| 3| 5| 5| 3| 3| 5|

38. Plant PCR Chloroplast DNA • Self-replicating DNA, 120 – 220 kb pairs • Highly conserved gene order • Contains genes that encode for tRNA (highly conserved across species)  nucleotide sequences identical in the chloroplast DNA of almost all higher plants ‘consensus’ or ‘universal’ oligonucleotide primers

39. Plant PCR Chloroplast DNA • higher frequency of mutations in non-coding stretches of cpDNA which lie between genes  relatively high rates of evolutionary change • amplification of non-coding regions of DNA between genes may be used to show differences in the cpDNA of different populations

40. Amplification of chloroplast DNA 5’ 3’ 5’ 3’ oligonucleotide primer highly conserved region of cpDNA variable (non-coding) region of cpDNA CHc: 5’CGAAATCGGTAGACGCTACG3’ CHd: 5’GGGGATAGAGGGACTTGAAC3’ Primers Plant PCR

41. Plant PCR PCR cycle • 94°C for two minutes to ensure maximum separation of the strands • Thirty cycles of: 94°C for 30 seconds 55°C for 30 seconds 72°C for 45 seconds (at final stage 2 minutes) PCR product can now be refrigerated or frozen

42. Plant PCR Gel electrophoresis • negatively charged DNA moves towards the anode • gel is porous  small molecules travel through gel more easily than larger molecules  in a given time, smaller DNA fragments travel further than larger DNA molecules through a gel

43. Plant PCR The distance moved on the gel by the amplified cpDNA varies according to its length. Bands which move the same distance but which are from different plants indicate that the lengths of DNA amplified is the same. This may indicate that these plants are genetically similar. To gain a more complete phylogenetic picture, many primer pairs would require to be used to provide comparisons over a greater range of the organisms’ DNA

44. Edexcel • Unit 5H: genetics, human evolution and biodiversity Gene Technology: understand how the polymerase chain reaction amplifies genetic material AQA • Module 2: Making Use of Biology The use of PCR…… Plant PCR

45. Higher Biology • Unit 1 Cell Biology d) Synthesis and release of proteins – the role of DNA, RNA and cellular organelles • Unit 2 Genetics and Adaptation: Selection and speciation Higher Human Biology • Unit 1, Cell function and inheritance b) protein synthesis: Role of DNA, RNA and cellular organelles Plant PCR

46. Higher Biotechnology • Unit 1, Microbiology: b) 3. Copying and translating genes c) Genetic engineering • Unit 3, Biotechnology: b) 2.Clinical and forensic medicine applications Advanced Higher Biology • Cell and Molecular Biology: d) Applications of DNA Technology Plant PCR

47. Plant PCR - staining

48. Plant PCR - staining Using the plastic ‘card’, gently scoop the gel from the tank into the tray.

49. Plant PCR - staining Pour ‘Fast Blast’ stain over and leave for three minutes exactly, then pour off stain and wash in warm water.

50. Royal Society of Edinburgh • Scottish Executive Plant PCR • Kenny Hamilton, Biology teacher at Breadalbane Academy, who worked with us on an RSE Teaching Fellowship • Dr Craig Simpson - Scottish Crop Research Institute • Dr Jan Barfoot - Scottish Institute for Biotechnology Education • University of Edinburgh