1 / 33

Understanding DNA Replication Mechanisms in Biochemistry Studies

Explore the intricate process of DNA replication in biochemistry, including conservative, non-conservative, and semi-conservative methods. Learn about replication forks, directionality, DNA polymerase, and initiation at replication origins.

cemmons
Télécharger la présentation

Understanding DNA Replication Mechanisms in Biochemistry Studies

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. CHMI 2227EBiochemistry I Nucleic acids: replication CHMI 2227 - E.R. Gauthier, Ph.D.

  2. DNA Nucleus DNA replication CHMI 2227 - E.R. Gauthier, Ph.D.

  3. 5’AGCTAGCTGATATCGCGATCG3’ 3’TGCATCGACTATAGCGCTAGC5’ 5’AGCTAGCTGATATCGCGATCG3’ 3’TGCATCGACTATAGCGCTAGC5’ 5’AGCTAGCTGATATCGCGATCG3’ 3’TGCATCGACTATAGCGCTAGC5’ DNA replication CHMI 2227 - E.R. Gauthier, Ph.D.

  4. DNA replication CHMI 2227 - E.R. Gauthier, Ph.D.

  5. Non-conservative Conservative Dispersive Semi-conservative DNA replication1) Conservation of the parental strands CHMI 2227 - E.R. Gauthier, Ph.D.

  6. PNAS 1958;44;671-682 DNA replication1) The Meselson and Stahl experiment CHMI 2227 - E.R. Gauthier, Ph.D.

  7. Replication forks DNA replication2) Directionality of replication CHMI 2227 - E.R. Gauthier, Ph.D.

  8. 5’ 5’ Replication fork 3’ 5’ 3’ Direction of the replication fork 3’ 5’ DNA replicationThe replication fork 3’ CHMI 2227 - E.R. Gauthier, Ph.D.

  9. DNA replicationLarge DNA molecules can have multiple origins of replication CHMI 2227 - E.R. Gauthier, Ph.D.

  10. DNA replication2) Directionality of replication 3’ 5’ 5’ 3’ 3’ 5’ 5’ 3’ CHMI 2227 - E.R. Gauthier, Ph.D.

  11. DNA replication2) Directionality of replication CHMI 2227 - E.R. Gauthier, Ph.D.

  12. DNA replication2) Directionality: Okazaki fragments CHMI 2227 - E.R. Gauthier, Ph.D.

  13. DNA replicationThe replication fork CHMI 2227 - E.R. Gauthier, Ph.D.

  14. DNA replication3) Nature of the replication machinery CHMI 2227 - E.R. Gauthier, Ph.D.

  15. DNA replication3) DNA polymerase CHMI 2227 - E.R. Gauthier, Ph.D.

  16. DNA replication3) DNA polymerase CHMI 2227 - E.R. Gauthier, Ph.D.

  17. DNA replication3) DNA polymerase CHMI 2227 - E.R. Gauthier, Ph.D.

  18. DNA replication3) DNA polymerase III of E. coli CHMI 2227 - E.R. Gauthier, Ph.D.

  19. (Clamp loader) (DNA polymerase) DNA replication3) DNA polymerase III of E. coli CHMI 2227 - E.R. Gauthier, Ph.D.

  20. DNA replication3) DNA polymerase III of E. coli http://oregonstate.edu/instruction/bb492/figletters/FigG1.html CHMI 2227 - E.R. Gauthier, Ph.D.

  21. Put DNA Here! Direction of replication Sliding clamp DNA replication3) DNA polymerase III of E. coli CHMI 2227 - E.R. Gauthier, Ph.D.

  22. DNA replication3) Primase CHMI 2227 - E.R. Gauthier, Ph.D.

  23. DNA replicationInitiation at the origin of replication CHMI 2227 - E.R. Gauthier, Ph.D.

  24. Unwinds DNA http://oregonstate.edu/instruction/bb492/figletters/FigH4.html DNA replicationLeading strand synthesis CHMI 2227 - E.R. Gauthier, Ph.D.

  25. DNA replicationLagging strand synthesis CHMI 2227 - E.R. Gauthier, Ph.D.

  26. DNA replicationLagging strand CHMI 2227 - E.R. Gauthier, Ph.D.

  27. Lacking Phosphodiester bond DNA replication - DNA ligase CHMI 2227 - E.R. Gauthier, Ph.D.

  28. DNA replication4) Proofreading CHMI 2227 - E.R. Gauthier, Ph.D.

  29. DNA replication4) Proofreading CHMI 2227 - E.R. Gauthier, Ph.D.

  30. DNA sequencing CHMI 2227 - E.R. Gauthier, Ph.D.

  31. PCR CHMI 2227 - E.R. Gauthier, Ph.D.

  32. PCR CHMI 2227 - E.R. Gauthier, Ph.D.

  33. CHMI 2227 - E.R. Gauthier, Ph.D.

More Related