360 likes | 532 Vues
BI420 – Course information. Web site: http://bioinformatics.bc.edu/~marth/BI420. Instructor: Gabor Marth. Teaching assistant: Aaron Quinlan. BI420 – Material. Lectures (PowerPoints posted on web site). Text. BI420 – Discovery questions. http://www.aw-bc.com/geneticsplace/.
E N D
BI420 – Course information Web site: http://bioinformatics.bc.edu/~marth/BI420 Instructor: Gabor Marth Teaching assistant: Aaron Quinlan
BI420 – Material Lectures (PowerPoints posted on web site) Text
BI420 – Discovery questions http://www.aw-bc.com/geneticsplace/
BI420 – Discovery questions Page 36, Discovery question #1.
BI420 – Discovery questions GGGCTCAGCTGTATCAGCCACGTGCCTACAACAATCTGCCCCT
BI420 – Introduction to Bioinformatics Genome organization and Bioinformatics Gabor T. Marth Department of Biology, Boston College marth@bc.edu
1. The informatics of DNA sequencing DNA sequencing informatics
look at multiple sequences from the same genome region • use base quality values to decide if mismatches are true polymorphisms or sequencing errors 3. Polymorphism discovery and analysis
11. Practical Bioinformatics using LINUX programming in PERL
12. Practical Bioinformatics CLONE id name received masked 1 NH0260K08 12-25-99 12-26-99 2 NH0407F02 12-28-99 01-03-00 HIT id cloneID hspID start end 1 1 1 1 17957 2 2 1 96912 114891 ALLELE id hitID nucleotide 1 1 C 2 2 T using and building databases