clio
Uploaded by
10 SLIDES
291 VUES
100LIKES

Formative Assessments

DESCRIPTION

Formative Assessments. JiTT Quiz Think-pair-share 1-minute paper Clickers with peer discussion Group work followed by report-out Jigsaw Concept maps Homework Projects Many others!. Formative assessments have multiple roles in the classroom 1. Assessments help confront misconceptions.

1 / 10

Télécharger la présentation

Formative Assessments

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Formative Assessments JiTT QuizThink-pair-share 1-minute paper Clickers with peer discussion Group work followed by report-out Jigsaw Concept mapsHomework ProjectsMany others!

  2. Formative assessments have multiple roles in the classroom1. Assessments help confront misconceptions (http://www.learner.org/resources/series26.html)

  3. A small acorn grows into a large tree. What contributes most to this biomass? a. sun b. water c. air d. soil

  4. 2. Assessments help students distinguish between what they know and what they don’t know.

  5. Genetic diseases, like Phenlyketonuria (PKU), confirm that there is a link between an individual’s DNA and that individual’s proteins. Below is a DNA molecule and the amino acid sequence that would result from translating the DNA sequence. 3’CGTTTTACCAAACCGAGTACTGAG 5’GCAAAATGGTTTGGCTCATGACTC TRP-PHE-GLY-SER Which nucleotides are responsible for this particular sequence of amino acids? As a group, write down what you know about DNA and proteins on one side of the white board. On the other side, write what else you need to know to be able to answer this question.

  6. 3. Assessments can provide a gauge of progress

  7. Feedback from clickers informs you and your students • Value of peer discussion

  8. dominant recessive • Imagine that earlobe attachment is dictated by a single gene (a simplification), yielding two traits: unattached and attached. • Unattached earlobes are due to the dominant allele (top picture) • Attached earlobes are due to the recessive allele (bottom picture) • From this information, you can conclude: • Attached earlobes are seen less frequently than unattached earlobes in a population • Attached earlobes are seen more frequently than unattached earlobes in a population • Either phenotype could be seen more frequently in a population: you need more information Clicker example Initial After discussion

  9. 4. Formative assessment can aid construction of new knowledge

  10. Darwin at the Olympics (For this exercise, pretend you are a student who is just learning about natural selection) • Work with your group to modify the 100-meter dash such that it would become an example of natural selection. Which are actual examples of natural selection, and why?

More Related