230 likes | 355 Vues
Developmental Trajectories to PTSD: Genes and Environment. Karestan C. Koenen, Ph.D. Departments of Society, Human Development & Health & Epidemiology. Posttraumatic Stress Disorder. Exposure to potentially-traumatic event 3 clusters of symptoms: Reexperiencing Avoidance/numbing
E N D
Developmental Trajectories to PTSD:Genes and Environment Karestan C. Koenen, Ph.D. Departments of Society, Human Development & Health & Epidemiology
Posttraumatic Stress Disorder • Exposure to potentially-traumatic event • 3 clusters of symptoms: • Reexperiencing • Avoidance/numbing • Arousal • Duration of at least 1 month • 50% becomes chronic and lasts many years American Psychiatric Association, 1994
Traumatic Events are Common In the General Population NESARC WAVE 2 2008
Lifetime PTSD Prevalence in the General U.S. Population: 11% in Women 5.5% in Men But the Prevalence is Increasing . . . Hurricane Katrina PTSD Prevalence 30% One Year Later (Galea et al 2008) Inner City Residents PTSD Prevalence ~>40% (Schwartz et al 2005) OIF/OAF Veterans PTSD Prevalence ~20% (Hoge et al. 2004)
Public Health Consequences of PTSD • Secondary mental disorders & suicide • Impaired role functioning • 3.6 days work impairment per month • Productivity loss of $3 billion per year to the US • Reduced life course opportunities • Greater health care utilization • Increased risk of negative physical health outcomes
Only Some Who Experience a Potentially Traumatic Event Develop PTSD NESARC Wave 2
Genetics of PTSD • What we know: • PTSD is heritable, ~33% of the variation in risk for PTSD is due to genetic factors (True et al., 1993; Stein et al., 2002) • What we want to know: • Which variations in inherited DNA sequence influence response to traumatic events • Central hypothesis of G-E research: • The effect of genotype (inherited DNA sequence) on risk of PTSD will be conditional on environmental conditions – such as severity of trauma exposure
genome locus gene site Genetics of PTSD: One Possible Visualization Pair of Chromosomes (2 Strands of DNA each) Note: this is a simple schematic of the hierarchy, so these subdivisions should not be taken too literally. For example, a site does NOT have to be within a gene, and the terms locus / gene / site are often used interchangeably in the literature.
FK506 Binding Protein 5 (FKBP5) • Cochaperone of stress proteins • Single nucleotide polymorphisms (SNPs) associated with variation in glucocorticoid receptor sensitivity and, therefore, HPA axis response • Polymorphisms in FKBP5 thought to result in “more rapid onset of stress hormone hyperactivity after stressful life events” (Binder et al., 2004)
FKBP5 & Peri-Traumatic Dissociation Mean & 95% CI RS3800373 Genotypes Koenen et al., Molecular Psychiatry, 2005
Mean PTSD Symptoms RS3800373 Genotypes Binder et al., JAMA, 2008
Serotonin Transporter (SLC6A4)Promoter Variant (5-HTTLPR) • Common polymorphism in promoter region regulates gene expression • Target for SSRI’s (e.g. Paxil) • Long variant = increased serotonin expression and function • Short variant = reduced serotonin expression and function • Genotypes: l/l or l/s or s/s TGACCGCACACACACACACA…..CACACACACACACAGTAAGCTT
2004 Florida Hurricane Study 4 Hurricanes hit Florida coast between August & September 2004 70 people died Property damage estimated > $40 billion
2004 Florida Hurricane Study Random digit dialing of ~600 older adults in 33 FL counties affected by the 2004 hurricanes PTSD assessed via National Women’s Study module Individual-level environment: social support, hurricane exposure, other traumatic events Social environment: county-level crime (1999 FBI) and unemployment rate (2000 Census) Buccal DNA collection via mail Genotyping for ancestry informative markers & 5HTTLPR Kilpatrick et al., American Journal of Psychiatry, 2007
Prevalence of Post-HurricanePTSD by 5-HTTLPR genotype and Stress Exposure % Kilpatrick et al. (2007) American Journal of Psychiatry
Prevalence of PTSD by 5-HTTLPR genotype and county-level crime rate %
Prevalence of PTSD by 5-HTTLPR genotype and county-level unemployment rate %
Conclusions • Emerging evidence that variation in inherited genetic code influences response to traumatic events • Effect of inherited genetic variation on risk for PTSD appears to be conditional on severity of individual-level trauma exposure and features of the broader social environment • Variation in inherited genetic code partially explains why - even at high levels of exposure -only some individuals develop PTSD
Implications Trauma exposure reveals an underlying inherited genetic vulnerability to PTSD PTSD is not caused by genes Gene-environment interaction studies provide information on the environmental conditions under which genetic variants increase risk of PTSD Further studies are needed to understand the function of these variants and implications for the underlying neurobiology of PTSD
Acknowledgements Injury Study Glenn Saxe Jordan Smoller Julie Kaplow Michelle Bosquet Erin Hall & Alisa Miller David Bartholomew Robert Casey Steve Moulton Clinton Baldwin Genetics Shaun Purcell Jordan Smoller Joel Gelernter Hurricane Study Dean Kilpatrick Ron Acierno Ken Ruggiero Sandro Galea Heidi Resnick John Roitzsch John Boyle Erin Backshis Allison Aiello Vietnam Era Twin Registry Q. John Fu Michael Lyons Karen Ertel Jack Goldberg Seth Eisen William True Ming Tsuang Funded by NIMH K08MH070627 & R01MH078928
References • Binder, E. B., Bradley, R. G., Liu, W., Epstein, M. P., Deveau, T. C., Mercer, K. B., et al. (2008). Association of FKBP5 polymorphisms and childhood abuse with risk of posttraumatic stress disorder symptoms in adults. JAMA, 299(11), 1291-1305. • Kilpatrick, D. G., Koenen, K. C., Ruggiero, K. J., Acierno, R., Galea, S., Resnick, H. S., et al. (2007). The serotonin transporter genotype and social support and moderation of posttraumatic stress disorder and depression in hurricane-exposed adults. Am J Psychiatry, 164(11), 1693-1699. • Koenen, K. C., Aiello, A. E., Bakshis, E., Amstadter, A. B., Ruggiero, K., Acierno, R., et al. (in press). County-level social environment modifies the association between serotonin transporter genotype and risk of post-traumatic stress disorder in adults. American Journal of Epidemiology. • Koenen, K. C., Nugent, N. R., & Amstadter, A. B. (2008). Gene-environment interaction in posttraumatic stress disorder: review, strategy and new directions for future research. European Archives of Psychiatry and Clinical Neuroscience, 258(2), 82-96. • Koenen, K. C., Saxe, G., Purcell, S., Smoller, J. W., Bartholomew, D., Miller, A., et al. (2005). Polymorphisms in FKBP5 are associated with peritraumatic dissociation in medically injured children. Mol Psychiatry, 10(12), 1058-1059. • Moffitt, T. E., Caspi, A., & Rutter, M. (2005). Strategy for investigating interactions between measured genes and measured environments. Arch Gen Psychiatry, 62(5), 473-481.