240 likes | 427 Vues
To demonstrate understanding, after this lesson, you should be able to. define mutations explain how mutations occur when – DNA Replication or Meiosis how – radiation &mutagenic chemicals recognize point (N-base) mutations (insertions, deletions and substitutions)
E N D
To demonstrate understanding, after this lesson, you should be able to • define mutations • explain how mutations occur when – DNA Replication or Meiosis how – radiation &mutagenic chemicals • recognize point (N-base) mutations (insertions, deletions and substitutions) • recognize chromosomal mutations (deletion, duplication, inversion, insertion, translocation)
I. Mutations • …are any change in the DNA of an organism. • May not have any affect or may cause a major deformation, illness.
I. Mutations • …are any change in the DNA of an organism. • May not have any affect or may cause a major deformation, illness.
I. Mutations Any change in DNA is a mutation. caused by mistakes during… • DNA replication of mitosis • Transcription • meiosis Also can be caused by environmental factors like… • Radiation • Carcinogens
Mutations in Reproductive (Sex) Cells VS. Body cells -Mutations in sex cells a.k.a. gametes (sperm and egg cells) can be passed down to a person’s children, but might not affect the parent -Mutations in body cells cannot be passed on to your children, however, they can cause cancer or other problems
II. Cancer as a result of mutations in body cells: Carcinogens- environmental/chemical factors that cause cancer Tongue cancer and lung cancer are often caused by changes in body cells as a result of smoking, so don’t smoke!!!
III. Gene Mutations • Point Mutation • only 1 codon is affected • example: “substitution mutation” AUC GGA UCC AUC CGA UCC THE FAT CAT WAS MAD THE FUT CAT WAS MAD
III. Point mutation mRNA Normal Protein Stop Replace G with A Point mutation mRNA Protein Stop
Point mutations in our lives! -Sickle cell anemia is a blood disease caused by a SUBSTITUTION point mutation. -A single nucleotide is changed from “A” to “T” which causes the amino acid to change from glutamic acid to valine: Amino acids: Thr – Pro – Glu – Glu Normal: ACT CCT GAG GAG Sickle cell: ACT CCT GTG GAG Amino acids: Thr – Pro – Val – Glu
Point mutations in our lives! -People with sickle cell anemia often experience a lot of pain and swelling and have trouble exercising.
IV. More Gene Mutations • Frameshift Mutations – • will affect several if not all of the following codons! (MAJOR PROBLEM!) • Example: “Deletion” – one base was left out. AAU CGA GGA … AAC GAG GA… (What is missing?) AAU CGA GGA … AAC GAG GA…
IV. Frameshift mutation -A frameshift mutation is when one nucleotide is inserted or deleted from the DNA or mRNA strand. -A frameshift mutation is worse…. WHY??? Ex: DNA TACTTCAAACCGCGTAACATT mRNA Protein
Difference between a substitution mutation and a frameshift mutation. substitution
THE FAT CAT WAS MAD… THE FAC ATW ASM AD… Deletions cause a shift in the codons…just like leaving a letter out, it makes no sense!
Other Frameshift Mutations: • “Insertion” – an extra base is added. ACC GAU GUC… ACU CGA UGU C… (What was added?) ACC GAU GUC… ACU CGA UGU C…
THE FAT CAT WAS MAD THE FAD TCA TWA SMA D… Once again, this makes no sense!
Questions: Is this a substitution mutation or a frameshift mutation? -It’s a substitution mutation because G was replaced with a T!
Questions: THE DOG BIT THE CAT THE DOG BIT THE CAR Substitution or frameshift? Substitution!
Questions THE DOG BIT THE CAT THE DOB ITT HEC AT Substitution or frameshift? Frameshift! The mutated sentence makes no sense (non-sense) and thus the protein will not be made
Chromosome Mutations • …are usually damaging. • An entire piece of a chromosome may be deleted, moved or damaged. • ALL INFORMATION ON THE AFFECTED SECTION MAY BE LOST OR FOREVER CHANGED (and is useless).
Types of Chromosome Mutations • Deletion – the whole chromosome is gone! • Duplication – now you have 2 sets of the same stuff. • Inversion – one part of a chromosome gets moved to another area on the SAME chromosome. • Translocation – a section of a chromosome is stuck on a DIFFERENT chromosome
Summarizing Can you… • define mutations • explain how mutations occur when – DNA Replication or Meiosis how – radiation &mutagenic chemicals • recognize point (N-base) mutations (insertions, deletions and substitutions) • recognize chromosomal mutations (deletion, duplication, inversion, insertion, translocation)