Les - omiques
Les - omiques. ENSPS 2 TIC-Santé 2012-2013. Plan. Introduction: La définition des – omiques et leurs apparitions en Biologie L’analyse de l’information dans les données Les génomes : de la cartographie au séquençage, Les ARN messagers : de l’hybridation au DNA chip,
Les - omiques
E N D
Presentation Transcript
Les -omiques ENSPS 2 TIC-Santé 2012-2013
Plan • Introduction: • La définition des –omiques et leurs apparitions en Biologie • L’analyse de l’information dans les données • Les génomes : de la cartographie au séquençage, • Les ARN messagers : de l’hybridation au DNA chip, • La protéomique : Du gel bidimensionnel à la spectrométrie de masse. L’interactome. • La métabolomique (l’analyse des métabolites)
Plan • Survol de la méthode • L’évolution des puces • Méthodes d’analyse
Measure of gene expression • Xenograf • Leukemia • Megacaryoblast • DNA arrays • Small oligos (Affymetrix) • Largeroligo(Agilent) • PCR quantitative • 96 wells plaques • 384 wellsMicroFluidicCards tutorial qPCR
Analysis of total RNA • Quality • Agilent 2100 Bioanalyzer (RNA 6000 Nano LabChip kit; 5 ng of total RNA (200 pg ARN 6000 Pico LabChip kit) • Ratio 28S/18S as a criteria for integrity Ratio rRNA 28S(4,7Kb)/ rRNA 18S(1,9Kb)~ 2 (>1,6) • Quantity • Purity • Quantity • SmartSpec 3000 (Biorad) • determined by UV absorption 260 nm. Yield Mouse Brain (400-450 mg), 350-400 µg of total RNA (Expectedfrom the protocol manufacturer, brain (1-1.5 µg RNA/mg tissue) Avantages Automation for better accuracy and reproducibility RNA are separated by capillary electrophoresis. Rapid visualisation of sample quality, quantity and purity High sensitivity with only a small amount of sample Significant time savings (up to12 samples in 30 minutes) Easy comparison or sharing of sample data Simple, robust protocols
Agilent Bioanalyser 1. The sample moves through the micro channels from the sample well. 2. The sample is injected into the separation channel. 3. Sample components are electrophoretically separated. 4. Components are detected by their fluorescence and translated into gel-like images (bands) and electropherograms (peaks).
Affymetrix platform: instruments total RNA • controls instrument Scanner 3000 and Fluidics Station 400. • provides array image acquisition • provides the interface for the Affymetrix Lims software for data storage and management • analyzes the array data GeneArray Chip Oven 640 Fluidics Station 400 GeneArray® Scanner Microarray Suite Software Raw data as an image (fichier .cel)
Total RNA AAAAAAA – 3' 5' TTTTTTT -5' T7 promoter Total RNA AAAAAAA – 3' 5' TTTTTTT -5' T7 promoter cDNA Eukaryotic Target Labeling for GeneChip® Expression Analysis 1. First Strand cDNA Synthesis (RT) 2. Second Strand cDNA Synthesis (Polymerase) cDNA AAAAAAA -3' 5' TTTTTTT -5' cDNA T7 promoter 3. Transcription (T7Polym, XTP, UTP-biotin) UUUUUU-5' 3’- Labeled-cRNA b b b b b b b b b b b
Gene expression monitoring with oligonucleotide arrays gene reference sequence ATGTGTGGATTACCCATCAGTACTAGTGGACTTGCCAATATCGGATGGA probesequence: PM ACCCATCAGTACTAGTGGACTTGCC probesequence: MM ACCCATCAGTACCAGTGGACTTGCC 1.28 cm 1.28 cm Oligo chip oligonucleotide arrays 20 mm Fluorescence intensity image PM probe set 25 mer-oligo MM probe pair 20 mm One probe cell mRNA gene: target 5’ 3’ 25 mer-oligo: probe
Affymetrix GeneChip® Arrays are manufactured through a process that combines photolithography and combinational chemistry.
Human Genome U133 (HG-U133) Set A (represent ~33,000 full-length genes and some EST clusters) . Specifications Number of Arrays in Set 2 Array Size Standard format Feature Size 20 µm Oligonucleotide Probe Length 25mer Probe Pairs/Sequence ~16 Sensitivity 1:100,000 Control sequences Hybridization controls bioB, bioC, bioD and cre Poly A controls dap, lys, phe, thr, and trp Maintenance Genes actin, GAPDH, hexokinase
# of pixels Intensity 300 75% percentile value Probe cell Avg Intensity = 300 CEL file • 1 Probe cell : 24m/24m • Scanning resolution : 3 m • 64 pixels (8x8) per probe cell in average
Lancement commercial Premier brevet microarrays 1st Catalog GeneChip® Product Roche AmpliChipTM launched Science West Sacramento Manufacturing Développement Technologique Marchés spécifiques Commercialisation Affymetrix Evolution U133 Set Collaboration avec Roche 10K SNP Array 1991 1992 1993 1994 1995 1996 1997 1998 1999 2000 2001 2002 2003
Expression génique A/B A/A B/B Analyse des SNPs A A A T A G G A T T G G C A T A C G T Reséquençage Un génome complet sur une puce Recherche Fondamentale Développement Pharmaceutique Recherche clinique Marché
* * * * * 5” 11µm 5” 11µm Millions de sondes identiques 1.28cm 1.28cm Environ 1,3 millions de cararés par puce Galette, Puces et carrés Puce/galette
Puces par galette 7 x 7 20 x 20 80 x 80 49 puces/galettes ~60K genes/puce 400 puces/galette ~2200 genes/puces 6400 puces/galette ~50 genes/puce
Graver plus fin Taille du carré 18um 11um 8um 5um 500,000 1,400,000 6,500,000 49 2,600,000 400 20,000 110,000 500,000 100,000 Format 4,900 1600 13,000 64,000 25,000 3,000 2500 8,000 40,000 16,000
Nombre de génes /puce Taille du carré 18um 11um 8um 5um 49 295,500 23,000 64,000 118,000 400 900 5,000 4,500 22,700 Format 1600 200 600 1,200 3,000 2500 150 400 2,000 750 *22 sondes par transcrit
Euros par carré Euros par carré La puissance de la photolitographie 600,000 500,000 400,000 Carré par puce 300,000 200,000 100,000 0 1996 1997 1998 1999 2000 2001 2002 Carré par chip
11 mm carré 20 mm 20 mm 2 mm carré 5 mm carré Diminution des carrés Produits actuels
Contrôle de qualité de la puce Vérification du design Vérification de la synthése Vérification du signal
Analyse de séquence Le dessin du masque est important Création Du masque A C G T GG Génotypage SNP PM MM Expression génique
Synthése combinatoire 4N sondes peuvent être synthétisé en 4 x N étapes 100 étapes 425 25mers (1.12 X1015 oligos ) Synthése linéaire: 500,000 25 mers = 12.5 m étapes + deposition 20,000 60 mers = 1.2 m étapes + deposition Résumé
Sample 2 Sample 3 Sample 1 Sources de variabilité Haut • Biologie • La source principale de variabilité • Préparation des échantillons • Dépends des échantillons • et de l’opérateur • Système • Dépends des puces, des appareils • Et de l’opérateur Bas
Software Data Analysis Fluidics Station Scanner Systéme affymetrix Puces
Applications Analyse ADN Taille Du marché Expression 1998 2000 2002 2004 2006 2010 2012 Time
Puces par organisme PROKARYA EUKARYA Rat Human E. coli Mouse Drosophila P. aeruginosa Yeast B. subtilis Arabidopsis C. elegans Sequence Databases http://www.genomesonline.org/cgi-bin/GOLD/index.cgi
Recherche Phase 0 Discovery Validation et Optimisation Essais cliniques et pré-cliniques Applications cliniques Publications utilisant les puces # of publications/annum Utilisation des puces
Validation et Optimisation Recherche Phase 0 Discovery Validation and Optimization Essais cliniques et pré-cliniques Applications cliniques Validation de cibles
Essais cliniques et pré-cliniques Discovery Validation and Optimization Pre-Clinical and Clinical Trials Applications cliniques • Toxicologie • Presque tous les essaiscliniques GeneChip Technology in Pharma/Healthcare Continuum
Description Produit Liaison et association • 2006 : 500K Genome entier Cartographie fine Reduction pour des gènes candidats • Tag arrays Analyse Séquence Identification Des variants • CustomSeq • Future: 10x • Expression analysis • Tag arrays • NetAffx Transcriptome Tests fonctionnels Compréhension d’une maladie génétique Glazier, Nadeau, & Aitman, Science 20 Dec 2002, p. 2345
+ 100 10,000 + 500K SNPs et plus …
De 400 microsatellite à 1 SNP pour 100Kb Blue = microsatellites Black = Gaps in coverage Red = at least 1 SNP per 100 kb
Nombre de SNPs par puces Taille d’un carré 18um 11um 8um 5um 49 65,000 12,500 35,000 162,500 400 2,500 500 2,750 12,500 Format 1600 125 625 325 1,600 2500 75 400 200 1000 * 40 sondes par SNPs
A A A T A G G A T T G G C A T A C G T Reséquençage • Reséquence 30 Kb
Nombre de base/ puce Taille du carré 18um 11um 8um 5um 49 812,500 63,000 175,000 325,000 400 62,500 2,500 14,000 12,500 Format 500 1600 8,000 1,600 3,000 375 2500 1,000 5,000 2,000 *8 sondes par base
Recherche clinique et génomique appliquée Recherche clinique Marché 1998 2000 2002 2004 2006 2010 2012 Temps
NCCLS Aspects réglementaires
Obtention des échantillons Dessin des puces Préparation et hybridation Analyse et rapport Pipeline en recherche clinique
Applications cliniques Recherche Validation et Optimisation Recherche clinique Clinical Applications Les applications en clinique
Roche AmpliChipTM • AmpliChip CYP450 • CYP2D6 & CYP2C19 genotyping • Analyzes 2 CYP2C19 and 31 CYP2D6 alleles • Accounts for ~99% of known poor and ultra-rapid metabolizer genetic variation worldwide “Powered by Affymetrix” * Photo courtesy of Roche Diagnostics
Génomique appliquée Applications chez l’homme Agro-alimentaire • Identification • Diagnostique • Tests Microbiologie Génomique des plantes
Environnement Agro-alimentaire Diagnostique Tracabilité des aliments Agriculture Santé humaine Recherche fondamentale Médecine personalisée Les puces à ADN Une révolution en génétique