1 / 52

Litao Yang, Dabing Zhang , zhen Li College of Life Science and Biotechnology

China-UK Bilateral Workshop on Modern Biology & its Social Impact. Activities of GMOs analysis in China. Litao Yang, Dabing Zhang , zhen Li College of Life Science and Biotechnology. Authorized AgGMOs in the world and China AgGMOs regulation and labeling in China GMOs analysis:

dafydd
Télécharger la présentation

Litao Yang, Dabing Zhang , zhen Li College of Life Science and Biotechnology

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. China-UK Bilateral Workshop on Modern Biology & its Social Impact Activities of GMOs analysis in China Litao Yang, Dabing Zhang, zhen Li College of Life Science and Biotechnology

  2. Authorized AgGMOs in the world and China AgGMOs regulation and labeling in China GMOs analysis: -Detection labs of GMOs in China -Development of GMOs analysis methods in China -Reference molecules -Chinese standards -Database of GMOs analysis -Challenges on GMOs analysis in China -International cooperation.

  3. Global Area of Growing GMOs (2006) • (Total 102.0 Million Hectares)

  4. Chinese GM-plants approved for commercialization

  5. 21 GM crops from foreign countries approved for importing as processed materials in China 1 soybean: GTS 40-3-2 (for processed use only, 3 years ) 9 corn varieties: Bt-corn Mon810, Bt11,Bt176,Mon 863,NK603,GA21, T25, MON59122,TC1507 (for processed use only, 3 years ) 7 canola varieties:Ms1Rf1、 Ms1Rf2、 Ms8Rf3、GT73、T45、Oxy235、Tapos 19/ 2(for processed use only, 3 years ) 4 cotton varieties:MON531, MON1445, MON15985, LLcotton 25 (used for 3 years)(for processed use, 5 years ) MOA 2007

  6. －－A science-based regulatory approach • AgGMOs regulation and labeling in China

  7. Regulatory regime Legislation systems

  8. Labelling Policies

  9. 17 kinds of GM products should be labeled Three labeling methods: GM raw materials: seeds GM products: containing detectable GM materials GM products: containing non-detectable GM materials

  10. Almost of the oil has been labeled with GM. Why consumer accept GMOs? Price of imported soybean is lower! 30 million tons of GM soybean to be imported in 2007

  11. GMOs analysis in China -Detection labs of GMOs -Development of GMOs analysis methods -Reference molecules -Chinese standards -Platform construction for GMOs analysis -International cooperation

  12. Detection labs of GMOs in China Official Entry-Exit Inspection and Quarantine Bureaus (23): Entry-Exit Inspection (1 lab involved in MOA system) Ministry of Agriculture (MOA) (49) : Domestic Inspection and Detection Non-official: Companies (GeneScan, SGS, etc)

  13. GM-plants and derived foods detection procedure

  14. Development of GMOs analysis methods in China －－PCR based methods (qualitative and quantitative) • Endogenous reference genes • Screening PCR method： CaMV 35S promoter; NOS terminator; nptII marker gene . • Gene-specific PCR method: Cp4-epsps、Cry1Ac、Cry1Ab、Cry9c • Construct-specific PCR method: Huafan No.1、GK19、SGK321、MON531、MON810、GA21 etc. • Event-specific PCR method: • Roundup Ready soybean • Nine GM maize lines (GA21, Bt11, Bt176, MON810, T25, Mon863, TC1507, NK603, and CBH351) • Seven GM canola lines (Oxy235, T45, Ms1Rf1, Ms1Rf2, Ms8Rf3, GT73, and Topas 19/2) • Two GM cotton lines (Bt-cotton531、RR-cotton 1445 ) • R&D Reference molecules

  15. Endogenous reference genes The importance of a reference gene Real Time quantitation of GM-event is based upon the notion of species-specific reference gene An optimal reference gene should be: 1. single (or low and known) copy number 2. low allelic variation in cultivars 3. species specificity Ideally, reference gene should be proposed by the scientific community as golden standard for a given taxon

  16. How many reference genes? Hmg (MON810), adh-70bp (NK603, MON863), adh-136bp (T25), Adh-136 (Bt11)” Maize Cotton Rice Canola Soybean Sugar beet Potato Tomato SAH7 (281-24-236x3006-210-23), Adh (LL25), Acp1 (Mon1445), Sad1 (L. Yang et al) Phospholipase D, SPS(J.Ding et al) Cruciferin (Ms1, Ms8, Rf1,2,3), Fat A (GT73), BnACCg8HMGI (H. Wen et al) Lectin 100bp (A2704-12), lectin 72bp (40-3-2) Glutamine synthetase UGP-ase Lat 52 (L.Yang et al) From CRL

  17. Zhongshuang No. 6 Zheshuang-758 Hunong No. 1 Jiaxing-9308 Suyou No. 1 Su-97-2126 Huyou-12 Su-991246 PGCP-59 Huyou-50 PGCP-57 PGCP-23 PGCP-55 An-437 PGCP-15 99bp 0.13 pg 1.3 pg 13 ng 1.3 ng 130 pg 13 pg Zheshuang-758 Suyou No. 1 Su-991246 PGCP-23 PGCP-55 PGCP-57 Huyou-12 Huyou-50 PGCP-15 An-437 2.0 kb Canola endogenous reference gene: HMG I/Y no allelic variation among the tested cultivars of B. napus. 13 pg DNA (about 10 haploid genomes) 1.3 pg DNA (about 1 haploid genome). Journal of AOAC International, 2005, 88 (2): 577-584

  18. Rice endogenous reference geneSPS(Sucrose-Phosphate Synthase) mung bean rapeseed tobacco carrot soybean A.thaliana sunflower arbutus pepper cotton eggplant tomato rice C21 Zhongyuzao18 P2C1 Huayuyihao Shenxiangjin No.6 D57 kholt marshi D20 BaSmati wheat Nonghu No. 6 D5 Heiheaihui barley maize C43βg94-1 C26 PR106 rice Xiushui04 xiangqing Hanfeng Taihunuo 20566 9520 81bp • One copy 055 5’TTGCGCCTGAACGGATATCTTTCAGTTTGTAACCACCGGATGACGCACGGACGGCTCGGA(probe)TCATCCCGAAAAGAT CAACCG 3’ 1135 dicotyledon species • No allelic variation among rice cultivars • Species specific gramineous varieties J.Agr.Food.Chem.2004 52(11)：3372-3377

  19. Dongnong No. 704 Nongyou No. 301 Shennong No. 2 negative control Maohong No. 1 Zhongsu No. 5 Hongza No. 10 Shenfen No. 2 Jiafen No. 1 Jifan No. 4 Xifen No. 3 Shuangfu Zaokuai Lichun Zaofen R144 Tomato seeds Ketchup tomato juice Tomato endogenous reference gene: Lat52 Yashu No. 6 Allelic variation analysis Southern blot analysis confirmed that this gene was single copy in the tested varieties Journal of Agriculture Food Chemistry 2005,50(2):122-125

  20. Zhongmiansuo 27 Chuanmian 243 Xiangzamian 2 Xuzhou 142 Wanmian 13 Liaomian 14 Sumian 15 Jinmian 16 Sumian 14 Numian 11 Chouyou 1 Yumian 22 Coker 312 Jimian 17 Simain 3 107 bp Cotton endogenous reference gene: SadI (Gossypium hirsutum) Stearoyl-Acyl Carrier Protein Desaturase G. barbadense, G. arboretum and G. herbaceum, Allelic variation analysis of 15 Gossypium hirsutum Plant Cell Reporter, 2005, 23: 759-763

  21. Inter-laboratory study on developed endogenous reference genes • Validation of endogenous reference gene, LAT52, used for GM tomato detection (8 countries/14 labs, finished) • Validation of endogenous reference gene, SPS, used for GM rice detection (Samples have been sent to each participants) • Validation of endogenous reference gene, Sad1, used for GM cotton detection (In preparing) • Validation of endogenous reference gene, HMG I/Y, used for GM canola detection

  22. Development of Chinese GMOs analysis methods using these new endogenous reference genes

  23. LOW HIGH Levels of specificity – GM targets(DNA) plant genomic DNA plant genomic DNA promoter intron gene terminator Screening targets Gene specific targets Construct specific Event specific targets Arne HA et al., Euro Food Res Tech, 2007

  24. mixed transgenic non-transgenic no template control mixed seeds conc= 10^(-0.308*CT + 10.235) R=0.9984 A PCaMV35S conc= 10^(-0.309*CT + 9.283) R=0.9986 195bp Nos Terminator Huafan construct specific fragment B 180bp C CaMV35s promoter Anti-EFE NOS terminator 153bp EcoR I Hind III Screen and construct specific detection of transgenic Huafan No.1 tomato conc= 10^(-0.290*CT + 8.125) R=0.9997 Journal of the Science of Food and Agriculture 85:2159–2166 (2005)

  25. Identification and quantification of three Genetically Modified insect resistant cotton lines using conventional and TaqMan real-time PCR methods

  26. non-GM soybean non-GM Mon531 SGK321 GK19 NTC non-GM maize CpTI (SGK321) Cry1A(c)-NOS(GK19,SGK321) Cry1A(c)-NOS- Mon531 CryIA(c) SadI mixture non-GM soybean non-GM cotton SGK321 Mon531 NTC GK19 Multiplex PCR J.Agr.Food.Chem.2005, 53, 6222-6229

  27. Event-specific PCR Detection of Genetically ModifiedMON1445 and MON531 MON1445 SGK321 MON531 2 cotton mixture Non-GM GK19 RRS NTC Bt11 MON1445 SGK321 MON531 Non-GM GK19 RRS NTC Bt11 0.05% 0.05% 0.01% 0.01% 0.5% 0.5% 0.1% 0.1% 5% 5% 3% 3% 1% 1% M 1 2 3 4 5 6 7 8 9 Single PCR Multiple PCR

  28. Quantitative PCR MON1445 MON531 LOD : 10 copies，LOQ :10 copies Coefficient Values of the reference moleculeof MON1445and MON531 were 0.47 and 0.44, respectively。 Transgenic Research,2005, 14, 817-831

  29. Event-specific PCR Detection of Genetically Modified Soybean GTS 40-3-2 GTS 40-3-2 MON1445 MON531 Non-GM NK603 RT73 GA21 NTC M 1 2 3 4 5 6 7 8 0.05% 0.01% NTC 0.5% 0.1% 5% 3% 1% M 1 2 3 4 5 6 7 8 9 Conc= 10^(-0.323*CT + 12.302) R^2＝0.9993 Specific analysis LOD:2 copies，LOQ: 20 copies。 Standard deviation repeatability and reproducibility were less than 0.2 Sensitivity analysis Coefficient Values of the reference molecule was 0.92 sample analysis

  30. Event-specific PCR Detection of Nine Genetically Modified Maizes（MON810、MON863、T25、BT11、TC1507、GA21、176、CBH351 and NK603）

  31. Standard Reference Moleculefor Genetically Modified Maizes LOD: 2～20 copies，LOQ:20 copies

  32. Coefficient Values of the reference molecule Based on the CVs,quantitative estimates of the maize samples were calculated J Agric Food Chem. 2005, 53, 9312-9318 J Cereal Sci. 2006, 43, 250－257. J Agric Food Chem. 2007, 55:15-24.

  33. Event-specific PCR detection of two GM-rapeseed （RT73 and T45） A B 0.05% 0.01% NTC 0.5% 0.1% 5% 3% 1% Ms3Rf8 Non-GM Ms1Rf2 RT73 NTC RRS Sensitivity analysis T45 176 B A B LOD andLOQ inevent-specific quantitative PCR detection of event T45 were 1 copy and 10 copiesrespectively;For RT73,LOD and LOQ were 10 copies and 100 copies respectively。 。 Specific analysis Based on the standard curve , rapeseed samples were analysised by quantitative PCR. （A）T45；（B）RT73

  34. R&D Reference molecules -The certified reference materials for GMOs analysis is not easily obtained. - Several CRMs have been R&D by IRMM, and series of CRMs might be purchased from Fluka. However, the price is very expensive, and the catalogue of CRMs did not contain the GMOs developed by China. - Reference molecule can used in GMOs analysis instead of CRMs -Novel reference molecules are being constructed for GMOs detection in China, such as 9 GM maize lines, 7 GM GM canola lines, 4 GM cotton lines,. Several CRMs were developed by IRMM, GIPSA, and ACOS, etc. • Ground seed materials • Genomic DNA • Plasmids

  35. Several RMs for GM soybean, maize and canola detection Yang et al., 2005 Yang et al., 2005 RMs for MON1445 and MON531 cottons RMs for Bt cottons detection

  36. RMs for RRS detection Yang et al., 2007 RMs for 9 GM maize lines detection

  37. Standards for GMOs detection in China Based on the gene-specific and event-specific PCR detection methods, respectively. Published standards (more than 20): NY/T 672-2003 Detection of Genetically Modified Plant Organisms and Derived Products －－General Requirements NY/T 673-2003 Detection of Genetically Modified Plant Organisms and Derived Products－－Sampling NY/T 674-2003 Detection of Genetically Modified Plant Organisms and Derived Products －－DNA Extraction and Purification NY/T 675-2003 Detection of Genetically Modified Plant Organisms and Derived Products －－Qualitative PCR Methods for Soybeans

  38. Detection of Genetically Modified Plant Organisms and Derived Products —— Qualitative PCR method for Bt cotton Detection of Genetically Modified Plant Organisms and Derived Products —— Qualitative PCR method for Bt Rice Detection of genetically modified plants and derived products ——Qualitative PCR method for insect-resistant and herbicide-tolerant maize event 176 and its derivate Detection of genetically modified plants and derived products ——Qualitative PCR method for insect-resistant and herbicide-tolerant maize event NK603 and its derivate Detection of genetically modified plants and derived products ——Qualitative PCR method for herbicide-tolerant canola event GT73 and its derivate

  39. GMO information exchange platform • GMO biosafety database • GMO detection method database • GMO detection, new method validation, and training service • GMO public education

  40. GMO Detection Method Database (GMDD) －－ http://gmdd.shgmo.org

  41. Search Interface:

  42. Diagram of Inserted DNA Inserted DNA Sequences

  43. Nucleic acid-based methods of GTS-40-3-2 soybean 4 types of PCR methods

  44. GA21 Validation Information PCR Program Reference

  45. Protein-based methods of GTS-40-3-2 CRMs

  46. GMDD is an open format database Submit interface

  47. Ongoing International cooperation EU: Official ENGL Meeting, RIKILT Institute of Food Safety USA: The Grain Inspection, Packers and Stockyards Administration (GIPSA),Proficiency Program Japan: NFRI Singapore: Agri-Food and Veterinary Authority Korea: Experiment Research Institute of National Agricultural Products Quality Management Service Kyung Hee University

  48. Summary • Validation of the novel endogenous reference genes of Tomato, Canola , rice and cotton; • Development and optimization of PCR detection method for GM soybean, corn, tomato, cotton, canola. Screening, Gene-specific, Construct-specific,Event-specific detection methods are developing. • Novel cotton、maize and soybean event-specific standard reference molecules for GMOs detection have been constructed instead of reference material. • GMO information exchange platform

  49. Challenges in further GMOs analysis • GMOs labeling threshold and its utilized detection method? • The accuracy of GM contents based on Quantitative RT-PCR? • Validation of CRMs and RMs for approved GMOs in China • Qualitative and quantitative detection for GMOs with stacked- gene? • Communication of GMOs analysis • Develop the GMO detection training course in China

More Related