Download
polimorfismos de nucleot deos nicos em esp cies polipl ides n.
Skip this Video
Loading SlideShow in 5 Seconds..
Polimorfismos de nucleotídeos únicos em espécies poliplóides PowerPoint Presentation
Download Presentation
Polimorfismos de nucleotídeos únicos em espécies poliplóides

Polimorfismos de nucleotídeos únicos em espécies poliplóides

134 Vues Download Presentation
Télécharger la présentation

Polimorfismos de nucleotídeos únicos em espécies poliplóides

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. Polimorfismos de nucleotídeos únicos em espécies poliplóides LGE - Laboratório de Genômica e Expressão Ramon Oliveira Vidal Email: ramon.vidal@gmail.com DoutorandoemGenética e Biologia Molecular Sub área: Bioinformática Orientador: Gonçalo A.G. Pereira @ramonvidal

  2. Tópicos da Apresentação • Marcadores Moleculares • Marcadores por Hibridação • Marcadores por Amplificação • Polimorfismos X mutações • SNPs • Origem • Aplicações • Haplótipos • Genotipagem • Identificando os SNPs (em genomas e transcriptomas) • Sanger • 454 • Solexa • Taxa de evolução • Identificação de SNPs em Coffeaarabica

  3. Fenótipo e Genótipo Fenótipo Propriedades observáveis de um indivíduo, que se desenvolveram sob a influência de: • genótipo do indivíduo • fatores ambientais • Genótipo • Constituição genética de um organismo como revelada pela análise genética e molecular, ou seja, o conjunto completo de genes, tanto dominantes e recessivos.

  4. Marcadores • Qualquer característica morfológica ou molecular que diferencia indivíduos, e que seja facilmente detectável

  5. Marcadores Morfológicos É um fenótipo de fácil identificação, normalmente determinado por um único alelo. Características fenotípicas de fácil identificação visual são utilizadas como marcadores morfológicos desde os tempos de Mendel

  6. Marcadores de DNA (moleculares) Polimorfismo detectado na seqüência de DNA • Vantagens: - Não é objeto de influências ambientais; - Praticamente ilimitado em número; Maior desvantagem é a necessidade de técnicas e equipamentos mais complexos.

  7. CaracterísticasDesejáveisaosmarcadoresmoleculares • Reprodutibilidade; • Amplamente distribuído através do genoma; • Poder de discriminação; • Ausência de influências ambientais; • Barato; • Fácil de mensurar

  8. Alguns conceitos básicos • Diplóide: Constituído por duas cópias (homólogos) de cada cromossomo. • Alelo: As formas alternativas de um caráter genético encontrado em um determinado locus de um cromossomo. • Homozigotos: Um organismo diplóide com alelos idênticos de um determinado gene em ambos os cromossomos homólogos. • Heterozigotos :Um organismo diplóide com alelos diferentes de um determinado gene em ambos os cromossomos homólogos.

  9. homozigoze Diplóide Alelos heterozigoze Haplóide

  10. Tipos de marcadores • Hibridação • RFLP – (Restriction Fragment Length Polymorphism) • Minissatélites – VNTR –(Variable Number of Tandem Repeats) • Amplificação de DNA • RAPD – (Random Amplified Polymorphic DNA) • SCAR (Sequence Characterized Amplified Regions) ou ASA (Amplified Specific Amplicon) • Microssatélites –SSR (Simple Sequence Repeats) • AFLP (Amplified Fragment Length Polymorphism)

  11. RFLP– Restriction Fragment Length Polymorphism

  12. RFLP– Restriction Fragment Length Polymorphism

  13. RAPD - Random Amplified Polymorphic DNA • Polimorfismo de DNA entre indivíduos pode ser devido a: • Ausência do sítio do primer. • Surgimento de um novo sítio. • Ao comprimento da região amplificada entre sítios de primer

  14. Microssatélites – SSR (SimpleSequenceRepeats) • Significa Seqüências Simples Repetidas, a qual consiste de pequenas seqüências de nucleotídeos (1 a 4) repetidas em tandem. • Essas seqüências são distribuídas ao acaso no genoma e é um dos marcadores mais utilizados atualmente

  15. Microssatélites – SSR (SimpleSequenceRepeats) • Primers específicos (20 a 30 pb). • Diferentes números de elementos simples repetidos. • Cada segmento amplificado de tamanho diferente representa um alelo diferente do mesmo loco

  16. Genótiposnaeletroforese

  17. Polimorfismos genéticos X Mutações genéticas • Mutações genéticas • Alteração na seqüência de nucleotídeos de uma molécula de DNA. • O termo "mutação“ é geralmente usado para referir-se a alterações na seqüência de DNA que não estão presentes na maioria dos indivíduos de uma espécie • Polimorfismos genéticos • Diferença na seqüência de DNA entre indivíduos, grupos ou populações. • Incluem SNPs, seqüências repetitivas, inserções, deleções e recombinações. • Podem dar origem a olhos ou olhos castanhos, cabelo liso ou cabelos crespo • Resultado de processos naturais ou induzidos por agentes externos (como vírus ou radiação).

  18. Polimorfismos genéticos X Mutações genéticas • Polimorfismossãoalterações no DNA que se mantémnasgeraçõesfuturas • Polimorfismo: variação>1% • Mutação: variação<1% C T T A G C T T C T T A G C T T 99.9% 94% C T T A G TTT C T T A G TTT 0.1% 6% Polimorfismo Mutação

  19. TAACAAT • Polimorfismosforammutaçõesque se propagaramaolongo de gerações TAAAAAT TAAAAAT TAACAAT TAAAAAT TAAAAAT TAACAAT TAACAAT TAACAAT Polimorfismos genéticos X Mutações genéticas TAAAAAT

  20. SNPs • Single Nucleotide Polymorphism, ou SNP ("snip"): • pequenamudança, ouvariação, quepodeocorrerem um úniconucleotídeonumasequência de DNA emumaporçãosignificativa (mais de 1%) de umapopulação.

  21. Single Nucleotide Polymorphism • SNPs são as maisfrequêntesformas de variaçõesgenéticas • 90% das variaçõesgenéticashumanasvêm dos SNPs • SNPs tem se tornado marcadores de preferênciapelasuagrandeabundância e pelodesenvolvimento de tecnologias de genotipagememlargaescala.

  22. Distribuição dos SNPs • SNPsem menor quantidade em genes do que em regiões não-codificantes • Menor quantidade de SNPs nos cromossomos sexuais (humano). • Dentro de um único cromossomo, SNPs podem se concentrar em uma região específica, geralmente implicando uma região de interesse ou de pesquisa. • Emmédia, ocorrem a cada 300~600 nucleotídeos (humano). • Genes com maiorpressãoparamodificação tem maiorfrequência de SNP (resistência, adaptação, interaçãoparasita-hospedeiro, etc)

  23. SNPs intra/inter específicos • Intra espécie • Diversidade entre os indivíduos de uma mesma espécie • Reflete os SNPs entre os alelos (espécies diplóides) • Inter espécies • Diversidade entre espécies diferentes

  24. Classificação dos SNP Transições Purina<->Purina Pirimidina<->Pirimidina Transversões Purina<->Pirimidina Não-codificantes Codificantes Sinônimas Não-sinônimas conservativas Não-conservativas

  25. Genotipagem • Detecção de genótipos de individuos. • Pode ser realizada observando os SNPs. • Haplótipo (genótipo haplóide) • Alelo encontrado em um único cromossomo que apresenta o mesmo padrão de SNPs. • Blocos haplótipos e tendem a ser herdados juntos. • Podem servir como marcadores de doença genética. • A análise de haplótipos é útil na identificação de eventos de recombinação.

  26. Blocos de haplótipos • Dentro de um blocohaplótipo, acontecepoucaounenhumarecombinação • Os SNPs dentro de um blocohaplótiposãopassadosjuntosnasgeraçõesfuturas

  27. CTC Haplotype 1 -A C T T A G C T T- -A C T T T G C T C- CAT Haplotype 2 ATC -A A T T T G C T C- Haplotype 3 SNP1 SNP2 SNP3 SNP1 SNP2 SNP3 haplótipos • Um haplótipo é um conjunto de SNP no mesmocromossomo

  28. Haplotype patterns : Major allele : Minor allele C1 C2 C1 Recombinationhotspots S1 S2 S3 SNP loci S4 Haplotypeblocks S5 S1 S2 S3 S4 S5 Chromosome Zonas de recombinação e Blocos de haplótipos I2 I1 C2 SNP loci

  29. Blocos de Haplótipos • SNPs estão relacionados com a diversidade de genótipos de humanos • podem ser mapeados relacionando-os a diversidade de fenótipos. • Um SNP individual ou um bloco haplótipo pode servir de indicação para • características agronômicas • doenças • etc • Essa relação constitui a base e a motivação para a identificação e genotipagem de SNPs.

  30. Genotipagem e utilizando SNPs comomarcadores • O genoma de cadaindivíduocontémdistintospadrões de SNPs • Pessoaspodem ser agrupadas de acordo com esseperfil • Perfil de SNPs sãoimportantesnaidentificação de respostas a terapias • Existeumacorrelação entre certosperfis de SNPs e respostasespecíficas a tratamentos

  31. Identificação de SNPs através da análise de sequencias • Genoma/transcriptoma • Sanger • 454 • Solexa/Solid/... • Alinhamento de sequências • Identificação de Discrepâncias

  32. Encontrando SNPs: Mineração de SNPs baseados no sequenciamento (Sanger tradicional) Genomic mRNA BAC Library RRS Library cDNA Library BAC Overlap Shotgun Overlap EST Overlap Sequenciamento De DNA

  33. Encontrando SNPs: Mineração de SNPs baseados no sequenciamento DNA from multiple individuals Fragment DNA Sequence and Reassemble (known sequence) Assembly with other overlapping mismatches = SNPs GTTACGCCAATACAGGATCCAGGAGATTACC GTTACGCCAATACAGCATCCAGGAGATTACC

  34. Amplificação do DNA Phred Phrap Sequenciamento Base-calling Contig assembly 5’ 3’ Vários indivíduos PolyPhred Polymorphism detection Consed Sequence viewing Polymorphism tagging Analysis Relatório de polimorfismos Genotipagem individual

  35. SNP Discovery - Sanger sequencing (EST)

  36. SNP Discovery - Diploids (heterozygous loci)

  37. Sequenciamentos de Nova geração para a identificação de SNPs

  38. Sangervs NGS • Método Sanger foi o únicoutilizadopor 30 anos • Sanger processaemparalelo 96 sequenciasenquanto NGS processamilhões de sequencias a um custo 6X menor. • Problemas: • Fidelidade dos dados • Tamanho dos reads • Custodainfraestrutura • Manipulargrandes volumes de dados

  39. Problemas do tamanhodasequência TCGTACCGATATGCTG • Sequenciascurtasnãomapeiamunicamenteem um lugar no genoma. • Solução#1: Reads longos. • Solução#2: Reads pareados. ACTTAAGGCTGACTAGC

  40. Sequenciamentos de Nova Geração

  41. Ferramentas para descoberta de SNPs em reads curtos • Necessário ter uma montagem de referência • Mapeamento dos reads na referencia • Coberturas médias necessárias: • Solexa - 100X, 454 - 10X • Análise estatística para validar discrepâncias com base na redundância dos dados • Muitos Softwares disponíveis • Desenvolvimento de algorítmos para aumentar velocidade de processamento

  42. http://seqanswers.com/wiki/Special:BrowseData

  43. SNP Discovery: Goal SNP sequencing errors

  44. SNP Discovery haploid diploid AACGTTAGCATA AACGTTAGCATA AACGTTAGCATA AACGTTAGCATA AACGTTAGCATA AACGTTCGCATA AACGTTCGCATA strain 1 individual 1 AACGTTCGCATA AACGTTCGCATA strain 2 AACGTTCGCATA AACGTTCGCATA AACGTTCGCATA AACGTTCGCATA AACGTTAGCATA AACGTTAGCATA AACGTTAGCATA individual 2 strain 3 AACGTTAGCATA AACGTTAGCATA individual 3

  45. Taxa de Evolução – kaksoudn/ds Para inferirumataxa de evolução a um gene sãoestimados o KA e o KS KA - é a relação entre substituiçõesnãosinônimas e todosospossíveissitiosnãosinônimos KS – é a relação entre substituiçõessinônimas e todosospossíveissítiossinônimos

  46. Exemplo: Prolina: • CCT • CCA • CCG • CCC Um sítiosinônimo e doisnãosinônimos

  47. KA/KS (dn/ds) • A taxa KA/KS é umamedidaclássicadaevolução de maneira global num gene • KA/KS << 1 indicaqueumasubstancialproporção de mudanças de aminoácidosdevemtersidoeliminadasporseleção de purificação. • KA/KS > 1 indicaseleçãoadaptativaoupositiva