1 / 15

Algorithms and Complexity 2: Complexity Notation

Algorithms and Complexity 2: Complexity Notation. John Levine John.Levine@cis.strath.ac.uk. Last time. What’s an algorithm then? Intro and brief history Sample use of algorithms Sample algorithm - room count Course overview Lectures, practical, labs/tuts, the exam. The travelling seller.

Télécharger la présentation

Algorithms and Complexity 2: Complexity Notation

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Algorithms and Complexity2: Complexity Notation John Levine John.Levine@cis.strath.ac.uk John Levine, Computer and Information Sciences, Strathclyde Universityhttp://www.cis.strath.ac.uk/~johnl/

  2. Last time • What’s an algorithm then? • Intro and brief history • Sample use of algorithms • Sample algorithm - room count • Course overview • Lectures, practical, labs/tuts, the exam John Levine, Computer and Information Sciences, Strathclyde Universityhttp://www.cis.strath.ac.uk/~johnl/

  3. The travelling seller • Mary, a computer seller, needs to visit 3 shops in a day (starting and finishing at the office): what’s the shortest route? • What if there’s 12 shops? 8km 5km 2km 12km 3km John Levine, Computer and Information Sciences, Strathclyde Universityhttp://www.cis.strath.ac.uk/~johnl/

  4. Today • Size matters • Complexity notation • Calculating complexities 2 John Levine, Computer and Information Sciences, Strathclyde Universityhttp://www.cis.strath.ac.uk/~johnl/

  5. Download time from internet • Say it takes 2s to establish a link and then we download at 5K/s, then if n is size of file in K: • time to download is n/5 + 2 • a linear function • dominant element as data size grows is n, so using big-oh notation = O(n) John Levine, Computer and Information Sciences, Strathclyde Universityhttp://www.cis.strath.ac.uk/~johnl/

  6. String Search • Problem: • Find a string t in a longer string s • Simple approach i=0; found = false; while (!found) & (i<s.length) j = 0; oksofar = true; while (oksofar) & (j<t.length()) if (s.charAt(i+j)!=t.charAt(j)) oksofar = false; j++ found = oksofar; i++; John Levine, Computer and Information Sciences, Strathclyde Universityhttp://www.cis.strath.ac.uk/~johnl/

  7. Rules for big-oh notation • Only record the highest, dominant, factor • Ignore constants and multipliers • Kind of like rounding • 1,000,001 is roughly 1,000,000 • so you say O(n2) and not O(12n2) • 4n3 + 3n2 + 1000n + 2000000 = O(n3) • 3n3 + 5 = O(n3) John Levine, Computer and Information Sciences, Strathclyde Universityhttp://www.cis.strath.ac.uk/~johnl/

  8. Common classes of Big-Oh • In increasing complexity roughly: - logarithmic O(log n) - linear O(n) - lin-log O(n log n) - quadratic O(n2) - polynomial O(nk), k > 1 - exponential O(an), n > 1 - factorial O(n!), n > 1 John Levine, Computer and Information Sciences, Strathclyde Universityhttp://www.cis.strath.ac.uk/~johnl/

  9. Common classes of Big-Oh John Levine, Computer and Information Sciences, Strathclyde Universityhttp://www.cis.strath.ac.uk/~johnl/

  10. 2 3 n O(log n) O(n) O(n ) O(n ) O(n!) 1 10 sec 10 sec 10 sec 10 sec 10 sec 2 10 sec 10 sec 10 sec 10 sec 10 sec 4 10 sec 10 sec 10 sec 10 sec 10 sec 8 10 sec 10 sec 10 sec 11 sec 50 sec 16 10 sec 10 sec 10 sec 14 sec 663 years 32 10 sec 10 sec 11 sec 43 sec 8.34E+24 years 64 10 sec 10 sec 14 sec 5 min 4.02E+78 years 128 10 sec 10 sec 26 sec 35 min 1.22E+205 years 256 10 sec 10 sec 1 min 5 hours 512 10 sec 11 sec 5 min 37 hours 1,024 10 sec 11 sec 18 min 12 days 2,048 10 sec 12 sec 1 hours 3 months 4,096 10 sec 14 sec 5 hours 2 years 8,192 10 sec 18 sec 19 hours 17 years 16,384 10 sec 26 sec 3 days 139 years 32,768 10 sec 43 sec 12 days 1113 years 65,536 10 sec 1 min 2 months 8901 years 131,072 10 sec 2 min 6 months 71209 years 262,144 10 sec 5 min 2 years 569672 years 524,288 10 sec 9 min 9 years 4557377 years 1,048,576 10 sec 18 min 35 years 36 , 459 , 013 yrs Tyranny of complexity • 1000 items per sec plus 10 secs startup John Levine, Computer and Information Sciences, Strathclyde Universityhttp://www.cis.strath.ac.uk/~johnl/

  11. <= = >= • Big-Oh says “as the numbers grow the dominant factor will be no worse (<=) than given” • e.g. an O(n log n) function grows no faster than another t = n log n • Big-Oh is used for the worst case - we will mostly talk worst, sometimes expected but never best nor average • Also Ω(n) and θ(n) for >= and = John Levine, Computer and Information Sciences, Strathclyde Universityhttp://www.cis.strath.ac.uk/~johnl/

  12. Simple String Search Peter Piper picked a peck of pickled pepper;     A peck of pickled pepper Peter Piper picked.If Peter Piper picked a peck of pickled pepper,     Where’s the peck of pickled pepper Peter Piper picked? • Find pepper - lots of false starts • Can you do better? • Simple complexity is O(nm) John Levine, Computer and Information Sciences, Strathclyde Universityhttp://www.cis.strath.ac.uk/~johnl/

  13. Better string search • Start search at end and keep a table peter_piper picked a peck of pickled pepper pepperpiper_picked a peck of pickled pepper peter pepperpicked a peck of pickled pepper peter piper pepper a peck of pickled pepper peter piper pickedpepperk of pickled pepper peter piper picked a pecpepperickled pepper peter piper picked a peck pepperkled pepper peter piper picked a peck of picpepperepper peter piper picked a peck of picklpepperper peter piper picked a peck of pickledpepperr peter piper picked a peck of pickled pepper 10 steps instead of 50 (I think) what about longer text? what about fewer letters - e.g. DNA coding? AGCCCGAACATTTACGCCGCTGGCGACTGCACCG John Levine, Computer and Information Sciences, Strathclyde Universityhttp://www.cis.strath.ac.uk/~johnl/

  14. String search • Basic algorithm is O(nm) • Best algorithm is O(n) • BUT is much more complex • Have to think of when it matters • is data big enough for more complex soln • watch constants and multipliers John Levine, Computer and Information Sciences, Strathclyde Universityhttp://www.cis.strath.ac.uk/~johnl/

  15. Summary • Size matters • Complexity notation • Calculating complexities • Next time: start searching & sorting • Ask the class quiz John Levine, Computer and Information Sciences, Strathclyde Universityhttp://www.cis.strath.ac.uk/~johnl/

More Related