1 / 22

GENETICS

GENETICS. Pedigrees, Mutations and Karyotypes. Pedigree. Chart that shows how a trait and the genes that control it are inherited within a family. Female. Male. Affected Person. Carrier . Marriage. Connects Children & Parents. Twins. Homozygous Recessive Disorders.

daria
Télécharger la présentation

GENETICS

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. GENETICS Pedigrees, Mutations and Karyotypes

  2. Pedigree • Chart that shows how a trait and the genes that control it are inherited within a family Female Male Affected Person Carrier Marriage Connects Children & Parents Twins

  3. Homozygous Recessive Disorders • Must have two recessive genes to have the disorder • Examples: • Tay-Sachs: the body can’t break down a certain lipid so it builds up in the brain; it is a fatal disorder • Cystic Fibrosis: excess mucus accumulates in the digestive tract and lungs

  4. Dominant Allele Disorders • Rare because the offspring usually dies before sexual maturity is reached • If you have at least one dominant gene, you have the disorder • Huntington’s disease: disorder in which the brain deteriorates; doesn’t show symptoms until an individual is in his late 30’s or early 40’s

  5. Genetic Counseling • If a disorder is present in past family members, genetic counselors can give parents the probability of passing the genetic disorder to their children • Genetic counselors construct pedigrees and use tests (i.e. alpha-fetoprotein, PKU) to determine probabilities

  6. Mutations • Changes in the DNA that can involve one or more genes; Mutations can be: • Harmful: cause diseases or deformities • Helpful: organism is better able to survive • Neutral: organism is unaffected • If a mutation occurs in a sperm or egg cell, that mutation is passed onto offspring • If a mutation occurs in a body cell, that mutation affects only the organism and is not passed onto offspring

  7. Gene Mutations • Random changes in the sequence of nucleotides in DNA • It’s a mistake that’s made during replication or transcription • There are 4 types: • Base Substitution • Base Deletion • Base Insertion • Jumping Gene

  8. Base Substitution • One base is replaced by another base; this is also called a point mutation • ACGUCAGUA  Threonine—Serine—Valine • ACGUUAGUA  Threonine—Leucine—Valine • Depending on where the mutation occurs, it may have no affect on the protein • ACGUCAGUA  Threonine—Serine—Valine • ACGUCGGUA  Threonine—Serine—Valine • Wobble: Base pairing between codon and anticodon in which there is nonstandard pairing at the third position of the codon; allows more than one codon to pair with the same anticodon

  9. Base Deletion • Deletion of a base that disrupts the codons; also called a frameshift mutation • ACGUCAGUA  Threonine—Serine—Valine • ACGUAGUAC  Threonine--STOP

  10. Base Insertion • Insertion of a base that disrupts the codons; also called a frameshift mutation • ACGUCAGUAC Threonine—Serine—Valine • ACGUCGAGUAC  Threonine—Serine– Serine

  11. Jumping Genes • Occur when large stretches of DNA are inserted into the gene; this can disrupt the DNA sequence • ACGTCAGTAC • ACGTCTACTGACGTAAGTAC

  12. Chromosomal Mutations • Involve the entire chromosome • Deletion: a chromosome breaks and a piece of the chromosome is lost

  13. Chromosomal Mutations (cont.) • Duplication: part of a chromosome breaks off and is incorporated into its homologous chromosome; the homologous chromosome now has an extra copy of one of its parts

  14. Chromosomal Mutations (cont.) • Translocation: a part of a chromosome breaks off and attaches to a different, non-homologous chromosome

  15. Chromosomal Mutations (cont.) • Inversion: a part of a chromosome breaks off, turns around, and reattaches in the reverse order

  16. Genome & Karyotype • Genome: base sequence of all of the DNA in an organism • Karyotype: photograph of all of an organism’s chromosomes

  17. Nondisjunction • Failure of the chromosomes to separate during cell division • If it occurs during mitosis, the individual cell is affected, but the organism is not usually harmed • If it occurs during meiosis, the entire organism is affected

  18. Monosomy & Trisomy • Monosomy: the zygote has only one copy of a particular chromosome • Trisomy: the zygote has three copies of a particular chromosome • In humans, monosomy and trisomy are so disruptive in most chromosomes that it kills the embryo • In some chromosomes, however, the embryo survives, but it has developmental difficulties

  19. Diseases Caused by Nondisjunction • Down’s Syndrome • Caused by trisomy of chromosome 21 • Symptoms include mental retardation and a “moon” face • Trisomy 18 • Caused by trisomy of chromosome 18 • Symptoms include a webbed neck, severe mental retardation, and hernia (inguinal, umbilical, and diaphramatic) • 90% mortality by 1 year

  20. Diseases Caused by Nondisjunction (cont.) • Klinefelter’s Syndrome • Caused by trisomy of the sex chromosomes, XXY • Symptoms include lack of facial and body hair, rounded body type, and infertility • Turner’s Syndrome • Caused by monosomy of the sex chromosomes, XO • Symptoms include no sexual development, learning disabilities, infertility, heart & kidney abnormalities

  21. Diseases Caused by Nondisjunction (cont.) • Trisomy 13 • Caused by trisomy of chromosome 13 • Symptoms include severe mental retardation and hernias (inguinal and umbilical) • 72% mortality by 1 year

  22. Polyploidy • Nondisjunction occurs in all chromosome pairs • Almost always lethal in animals • Usually has a positive effect in plants

More Related