1 / 51

The Science and Facts Behind Genetically Modified Organisms

A u s t r a l i a ’ s G r o w i n g F u t u r e. The Science and Facts Behind Genetically Modified Organisms. Definition How to make a GMO Examples Concerns. Dr Rhonda Foley Research Scientist CSIRO November 2010. GMO- Acronym.

dayton
Télécharger la présentation

The Science and Facts Behind Genetically Modified Organisms

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. A u s t r a l i a ’ s G r o w i n g F u t u r e The Science and Facts Behind Genetically Modified Organisms • Definition • How to make a GMO • Examples • Concerns Dr Rhonda Foley Research Scientist CSIRO November 2010

  2. GMO- Acronym Genetically Modified Organism Definition: The genetic material of an organism has been modified

  3. Man has been genetically modifyingplants for ten thousand years. Corn Today Ancient Corn

  4. Selective breeding has altered the genes of crops 2000AD 1500BC

  5. GMO-Definition Revised Definition: The genetic material of an organism has been modified by transferring DNA using non-conventional breeding methods.

  6. Retroviruses transfer foreign DNA in to the host DNA e.g. AIDS

  7. GMO-Definition Re-Revised Definition: The genetic material of an organism has been modified by transferring DNA using biotechnology.

  8. MARKER FOR CEREAL CYST NEMATODE RESISTANCE IN WHEAT Cre1

  9. SELECTIVE BREEDING

  10. Understanding the biology behind GMOs • Plants are made of cells, each cell contains its set of ~30,000 genes • The set of genes in each cell is a recipe for the whole plant

  11. Chromosomes contain DNA

  12. Building blocks of DNA T G C A Exactly the same chemical found in bacteria, plants and animals

  13. DNA - CODED INSTRUCTIONS • ATGGCACAAATTAACAACATGGCACAAGGGATACAAACCCTTAATCCCAATTCCAATTTCCATAAACCCC AAGTTCCTAAATCTTCAAGTTTTCTTGTTTTTGGATCTAAAAAACTGAAAAATTCAGCAAATTCTATGTT GGTTTTGAAAAAAGATTCAATTTTTATGCAAAAGTTTTGTTCCTTTAGGATTTCAGCATCAGTGGCTACA GCCTGCATGCTTCACGGTGCAAGCAGCCGGCCCGCAACCGCCCGCAAATCCTCTGGCCTTTCCGGAACCG TCCGCATTCCCGGCGACAAGTCGATCTCCCACCGGTCCTTCATGTTCGGCGGTCTCGCGAGCGGTGAAAC GCGCATCACCGGCCTTCTGGAAGGCGAGGACGTCATCAATACGGGCAAGGCCATGCAGGCCATGGGCGCC AGGATCCGTAAGGAAGGCGACACCTGGATCATCGATGGCGTCGGCAATGGCGGCCTCCTGGCGCCTGAGG CGCCGCTCGATTTCGGCAATGCCGCCACGGGCTGCCGCCTGACCATGGGCCTCGTCGGGGTCTACGATTT CGACAGCACCTTCATCGGCGACGCCTCGCTCACAAAGCGCCCGATGGGCCGCGTGTTGAACCCGCTGCGC GAAATGGGCGTGCAGGTGAAATCGGAAGACGGTGACCGTCTTCCCGTTACCTTGCGCGGGCCGAAGACGC CGACGCCGATCACCTACCGCGTGCCGATGGCCTCCGCACAGGTGAAGTCCGCCGTGCTGCTCGCCGGCCT CAACACGCCCGGCATCACGACGGTCATCGAGCCGATCATGACGTGCGATCATACGGAAAAGATGCTGCAG GGCTTTGGCGCCAACCTTACCGTCGAGACGGATGCGGACGGCGTGCGCACCATCCGCCTGGAAGGCCGCG GCAAGCTCACCGGCCAAGTCATCGACGTGCCGGGCGACCCGTCCTCGACGGCCTTCCCGCTGGTTGCGGC CCTGCTTGTTCCGGGCTCCGACGTCACCATCCTCAACGTGCTGATGAACCCCACCCGCACCGGCCTCATC CTGACGCTGCAGGAAATGGGCGCCGACATCGAAGTCATCAACCTGCGCCTTGCCGGCGGCGAAGACGTGG CGGACCTGCGCGTTCGCTCCTCCACGCTGAAGGGCGTCACGGTGCCGGAAGACCGCGCGCCTCCGATGAT CGACGAATATCCGATTCTCGCTGTCGCCGCCGCCTTCGCGGAAGGGGCGACCGTGATGAACGGTCTGGAA GAACTCCGCGTCAAGGAAAGCGACCGCCTCTCGGCCGTCGCCAATGGCCTCAAGCTCAATGGCGTGGATT GCGATGAGGGCGAGACGTCGCTCGTCGTGCGTGGCCGCCCTGACGGCAAGGGGCTCGGCAACGCCTCGGG CGCCGCCGTCGCCACCCATCTCGATCACCGCATCGCCATGAGCTTCCTCGTCATGGGCCTCGTGTCGGAA AACCCTGTCACGGTGGACGATGCCACGATGATCGCCACGAGCTTCCCGGAGTTCATGGACCTGATGGCCG GGCTGGGCGCGAAGATCGAACTCTCCGATACGAAGGCTGCCTGA Glyphosate resistant gene

  14. What is a gene? PROTEIN MET CYS LYS PRO VAL HIS TGT CCA GTG TTT CAC ATG TAA START STOP Protein synthesis Protein synthesis Gene control (on/off; where, when, how much)

  15. How to make a GM plant 1. Agrobacterium Transformation 2. Biolistics

  16. Crown Gall Disease Agrobacterium- pathogen

  17. Agrobacterium Transformation • 1. Remove pathogenic • genes from Agrobacterium • 2. Add gene(s) of interest • Add selectable marker (usually antibiotic • resistant gene) to ‘see’ transformed plant

  18. 1cm

  19. Misunderstood facts about GMOs • All plants have genes even if they are not a GMO • The introduced gene acts genetically exactly the same as all other genes in the plant • It is not essential for a GM plant to contain a gene from another species, or even a functional gene

  20. Current GM crops approved in Australia • Purple Carnation • Cotton (insect and herbicide resistant) • Canola (herbicide resistant)

  21. GM canola vs Triazine Tolerant (TT) canola • Both canola types were produced by non-natural procedures to introduce a new herbicide resistant gene • TT canola has a 15-20% yield reduction • Triazine has negative safety issues (Banned in EU 2004) • There is no premium to produce GM-free canola products

  22. GMOs and CSIRO

  23. GM-cotton GM cotton CONVENTIONAL Bollworm Reduce insecticide use by over 80%

  24. Transgenic Barley Bread wheat Non-transgenic Barley Aluminium tolerance gene Pasta wheat ($20/tonne premium) Aluminium tolerance gene transferred from wheat to barley Wheat to Wheat transfer of Genes

  25. Animal requirement Lupin 2 GM lupin 1.8 1.6 1.4 % of total amino acid 1.2 1 0.8 0.6 0.4 0.2 0 methionine GM lupins increase liveweight gain and wool growth

  26. Virus immune white clover Clover viruses Reduce milk production by $73 million per year

  27. Bloat-safe pastures Cost: $180 million per year Cause: Lush pastures, low in tannin that cause a protein foam Sainfoin White clover Condensed tannin genes Lucerne

  28. Development of non-bruising potato Non-GM GM Traditional potato Non-bruising potato Also with apples, beans, sugarcane and lettuce

  29. Omega-3 plant oils IP3 • ω3 Long Chain-Poly Unsaturated Fatty Acids from fish are in short supply. • Human health benefits • genes for synthesis from micro algae

  30. Increased stearic oil – suitable as a healthy margarine hardstock Increasedoleicoil – suitable as a healthy cooking oil Requires costly hydrogenation process that produces trans-fatty acid Healthy cottonseed oil

  31. Industry Oils from Plants Dandelion Gene to produce ‘house-hold’ oil linseed

  32. Nitrogen Utilization • GM traits near commercial release • Better use of nitrogen fertilisers

  33. GM poppies GM poppies to produce non-addictive pain killers (morphine)

  34. Potential Uses of GMOs • GMOs for the farmer – herbicide resistance, pest resistance, enhanced crop yield, improved pastures • GMOs for the producer/retailer – bread-yeast improvements, longer shelf life • GMOs for the consumer – improved nutrition and health; medicines • GMOs for the environment - phytoremediation • GMOs for society/industry – new forms of energy

  35. Imagination is the limit Sunday Times 1st Feb 2004

  36. Golden rice 2,000,000 people die each year from Vitamin A deficiency 500,000 kids develop blindness per year caused by Vit A deficiency Insertion of provitamin A synthesis genes into rice Golden rice will be distributed free Currently still awaiting approval for release

  37. Why the concern with GMOs? The Economist, June 7th 2003

  38. Why the concern with GMOs? • Is it financially worth it? • New technology and new food

  39. New food is regarded with suspicion and as potentially poisonous Potatoes rejected in Europe (18th Century) as thought to cause leprosy, rickets and syphilis Maize was rejected by the Irish during the potato famine as the food was not trusted. Tomatoes were considered to be toxic and cause foaming in the mouth, appendicitis and cancer • My mum will not try sushi as she thinks she will not like it, and she may get sick

  40. New technology is regarded with suspicion • Socrates (~400 BC) – books will ‘create forgetfulness in the learners’ souls’

  41. New food and new technology e.g., – pasteurised milk took 14 yrs before being accepted by society Reclaimed water - 2008

  42. Institutional Biosafety Committee Research Office of the Gene Technology Regulator Development • Environmental safety checks • Human health and safety checks FSANZ, NRA, TGA, AQIS, EA Commercial release Regulatory control for GM crops

  43. Consumer choice GM food and ingredients must be labeled when: • They contain DNA and/or protein from the GMO (not oil) • GMO is present at more than 1% per ingredient • Are different from the non-GM version

  44. Two Methods to Improve Crop Yields • Farm Management 2. Alter the genes of the crop

  45. Methods to Alter the GenesPart 1 • Selection of desirable traits from ‘naturally’ occurring mutations 2. Accelerating mutations (eg by x-ray or carcinogenic chemicals)

  46. Methods to Alter the GeneticsPart 2 3. Breeding to different varieties with a desirable trait (eg herbicide resistance) • 4. GMOs - • specifically altering a desired gene(s) in a crop

  47. Methods to Alter the Genes • Natural occurring Mutations • Mutagenesis • Breeding • GMOs

More Related