1 / 38

Gene Expression and Gene Regulation Part 1

Gene Expression and Gene Regulation Part 1. Chapter 9. 9.1 The Link between Genes and Proteins. Archibald Garrod published a paper on the condition of alkaptonuria – he proposed that abnormal phenotypes resulted from biochemical defects or “inborn errors of metabolism ”

debbie
Télécharger la présentation

Gene Expression and Gene Regulation Part 1

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Gene Expression and Gene RegulationPart 1 Chapter 9

  2. 9.1 The Link between Genes and Proteins • Archibald Garrod published a paper on the condition of alkaptonuria – he proposed that abnormal phenotypes resulted from biochemical defects or “inborn errors of metabolism” 1941 George Beadle and Edward Tatum firmly established the link between genes, the proteins produced from those genes, and a visible phenotype (won the Nobel Prize in 1958)

  3. 9.3 Tracing the Flow of Genetic Information Production of protein from instructions on the DNA requires several steps - Transcription = Production of mRNA - Translation = Production of protein using mRNA, tRNA, and rRNA - Folding of the protein into the active 3-D form

  4. DNA Transcription pre-mRNA Cell mRNA processing Cytoplasm Nucleus mRNA Translation Polypeptide Fig. 9-2, p. 201

  5. Adenine (A) Adenine (A) Guanine (G) Guanine (G) Cytosine (C) Cytosine (C) Thymine (T) Uracil (U) RNA DNA Fig. 8-7, p. 183

  6. Nucleic Acids DNA RNA Usually double-stranded 1. Usually single-stranded Thymine as a bas 2. Uracil as a base Sugar is deoxyribose 3. Sugar is ribose Contains protein coding info 4. Carries protein code info Does not act as an enzyme 5. Can function as an enzyme Permanent 6. Transient Table 10.2

  7. Ribose • There are three major types of RNA • - messenger RNA or mRNA • - ribosomal RNA or rRNA • - transfer RNA or tRNA Ribose Ribose Ribose Fig. 8-11, p. 187

  8. 9.4 Transcription Produces Genetic Messages • Transcription begins when DNA unwinds and one strand is used as template to make a pre-mRNA molecule • Initiation: Binding of transcription factors and RNA polymerase to promoter region in the DNA • Elongation: RNA polymerase adds nucleotides in 5’  3’ direction • Termination: terminator sequence is reached

  9. Gene region 5’ Promoter region RNA polymerase, the enzyme that catalyzes transcription (a) RNA polymerase binds to a promoter in the DNA, along with regulatory proteins (initiation). The binding positions the polymerase near a gene in the DNA. Only one strand of DNA provides a template for transcription of mRNA. Fig. 9-3a, p. 200

  10. Newly forming RNA transcript DNA template winding up DNA template unwinding (b) The polymerase begins to move along the DNA and unwind it. As it does, it links RNA nucleotides into a strand of RNA in the order specified by the base sequence of the DNA (elongation). The DNA double helix rewinds after the polymerase passes. The structure of the “opened” DNA molecule at the transcription site is called a transcription bubble, after its appearance. Fig. 9-3b, p. 200

  11. Pre-mRNA must Undergo Modification and Splicing • Transcription produces large mRNA precursor molecules called pre-mRNA • Before leaving nucleus – mRNA is processed • 1. 5’ methyl cap added - Recognition site for protein synthesis • 2. 3’ poly A tail - Stabilizes the mRNA • 3. Removal of introns(intervening sequences- don’t code for protein)

  12. Unit of transcription in DNA strand Exon Intron Exon Intron Exon Transcription into pre-mRNA Cap Poly-A tail Snipped out Snipped out Mature mRNA transcript Fig. 9-4, p. 202

  13. Alternative Splicing

  14. Mutations in Splicing Sites and Genetic Disorders • Splicing defects cause several human genetic disorders • One hemoglobin disorder, b-thalassemia, is due to mutations at the exon/intron region that results in lower splicing efficiency and lower b-globin protein

  15. DNA Transcription pre-mRNA Cell mRNA processing Cytoplasm Nucleus mRNA Translation Polypeptide Fig. 9-2, p. 201

  16. 9.5 Translation Requires the Interaction of Several Components • Translation requires the interaction of mRNA, amino acids, ribosomes, tRNA molecules, and energy sources • mRNA is read in groups of 3 amino acids called codons

  17. Codon Chart—20 different amino acids to make all the proteins in living organisms

  18. Genetic Code • Triplet code (3 mRNA bases = 1 amino acid) • Redundant – more than one codon can specify an amino acid • Unambiguous – each codon codes for just one amino acid • Universal – nearly all organisms use the same code - bacteria, plants, animals

  19. INITIATION (a) A mature mRNA leaves the nucleus and enters the cytoplasm, which has many free amino acids, tRNAs, and ribosomal subunits. mRNA Initiator tRNA Small ribosomal subunit An initiator tRNA carrying methionine binds to a small ribosomal subunit and the mRNA. Large ribosomal subunit Fig. 9-9a, p. 206

  20. Transfer RNA (tRNA)

  21. (b) A large ribosomal subunit joins, and the cluster is now called an initiation complex. Fig. 9-9b, p. 206

  22. ELONGATION A peptide bond forms between the first two amino acids (here, methionine and valine). (c) An initiator tRNA carries the amino acid methionine, so the first amino acid of the new polypeptide chain will be methionine. A second tRNA binds the second codon of the mRNA (here, that codon is GUG, so the tRNA that binds carries the amino acid valine). Fig. 9-9c, p. 207

  23. A peptide bond forms between the second and third amino acids (here valine and leucine). (d) The first tRNA is released and the ribosome moves to the next codon in the mRNA. A third tRNA binds to the third codon of the mRNA (here, that codon is UUA, so the tRNA carries the amino acid leucine). Fig. 9-9d, p. 207

  24. A peptide bond forms between the third and fourth amino acids (here, leucine and glycine). (e) The second tRNA is released and the ribosome moves to the next codon. A fourth tRNA binds the fourth mRNA codon (here, that codon is GGG, so the tRNA carries the amino acid glycine). Fig. 9-9e, p. 207

  25. TERMINATION (f) Steps d and e are repeated over and over until the ribosome encounters a stop codon in the mRNA. The mRNA transcript and the new poypeptide chain are released from the ribosome. The two ribosomal subunits separate from each other. Translation is now complete. Either the polypeptide chain will join the pool of proteins in the cytoplasm, the nucleus, or will enter the rough ER of the endomembrane system (Section 4.9). Fig. 9-9f, p. 207

  26. Polysomes • Once a ribosome has started translation, new initiation complexes can form on an mRNA in order to produce many protein molecules.

  27. Template DNA: 3’TGTACGCGGTCAGCTTTATT5’ (red = introns) Mature mRNA: tRNA anticodons: Amino acids:

  28. Template DNA: 3’TGTACGCGGTCAGCTTTATT5’ (red = introns) Mature mRNA: AUG AGU CGA UAA tRNA anticodons: Amino acids:

  29. Template DNA: 3’TGTACGCGGTCAGCTTTATT5’ (red = introns) Mature mRNA: AUG AGU CGA UAA tRNA anticodons: UAC UCA GCU AUU Amino acids:

  30. **Mature mRNA: AUG AGU CGA UAA** tRNAanticodons: UAC UCA GCU AUU Amino acids: Methionine, Serine, Arginine, Stop

  31. H Amino group Carboxyl group R (a) Amino acid Fig. 9-6a, p. 203

  32. Each amino acid has a specific R-group.

  33. 9.7 Polypeptides are Folded to Form Proteins • After synthesis, polypeptides fold into a three-dimensional shape, often assisted by other proteins, called chaperones • Improper folding leads to incorrect protein structure and inability to perform function (Alzheimer, Huntington, Parkinson diseases) • Four levels of protein structure are recognized

  34. Four Levels of Protein Structure • Primary structure(1O) • The amino acid sequence in a polypeptide chain • Secondary structure(2O) • The pleated or helical structure in a protein molecule resulting from the peptide bonds between amino acids

  35. Four Levels of Protein Structure • Tertiary structure(3O) • The folding of the helical and pleated sheet structures due to interaction of the R-groups. • Quaternary structure(4O) • The interaction of two or more polypeptide chains to form a functional protein

  36. Levels of Protein Structure 1O 2O 3O 4O

  37. Exploring Genetics: Antibiotics and Protein Synthesis • Antibiotics are produced by microorganisms as a defense mechanism • Many antibiotics affect one or more stages in protein synthesis. For example: • Tetracycline: initiation of transcription • Streptomycin: codon-anticodon interaction • Erythromycin: ribosome movement along mRNA

  38. Other topics in Chp 9 Part 2 • Protein folding diseases • Regulation of protein synthesis occurs at several levels: • Timing of transcription • The rate of translation • The ways in which proteins are processed • The rate of protein break-down

More Related