110 likes | 211 Vues
Identification and selection of simple sequence repeats for mapping mutations in Arabidopsis thaliana. Adalberto Castelo, Apperson Johnson, Francisco Useche, Chu Zhang. ATCGGTA ATCGGTA ATCGGTA. SSRs. Multiple copies of the same DNA sequence lying in a line series. Cause of SSRs.
E N D
Identification and selection of simple sequence repeats for mapping mutations in Arabidopsis thaliana Adalberto Castelo, Apperson Johnson, Francisco Useche, Chu Zhang
ATCGGTAATCGGTAATCGGTA SSRs Multiple copies of the same DNA sequence lying in a line series. Cause of SSRs The increase or decrease of repeat length can occur due to the unequal crossover or slippage during replication.
Roles of Tandem Repeats • Mapping • Evolution • Disease related • Forensics • Relatedness • Identification
CACACACACACA White flower Red flower CACACACACACACACAC PCR Use SSR as molecular mapping markers SSR
Steps in SSR Process Get Sequences Find SSRs Store SSRs with Same Pats & Similar flanks in DB Find Primers Build Table of Results
Location and format of Sequences - Columbia The Institute for Genomic Research ftp://ftp.tigr.org/pub/data/a_thaliana/ath1/PUBLICATION_RELEASE/PSEUDOMOLECULES/ File: ATH1_pseudo_1.1con >68198 , , , 29782728 bp CCCTAAACCCTAAACCCTAAACCCTAAACCTCTGAATCCTTAATCCCTAAATCCCTAAAT CTTTAAATCCTACATCCATGAATCCCTAAATACCTAATTCCCTAAACCCGAAACCGGTTT CTCTGGTTGAAAATCATTGTGTATATAATGATAATTTTATCGTTTTTATGTAATTGCTTA TTGTTGTGTGTAGATTTTTTAAAAATATCATTTGAGGTCAATACAAATCCTATTTCTTGT GGTTTTCTTTCCTTCACTTAGCTATGGATGGTTTATCTTCATTTGTTATATTGGATACAA GCTTTGCTACGATCTACATTTGGGAATGTGAGTCTCTTATTGTAACCTTAGGGTTGGTTT ATCTCAAGAATCTTATTAATTGTTTGGACTGTTTATGTTTGGACATTTATTGTCATTCTT ...
Location and format of Sequences - Landsberg The Institute for Genomic Research Landsberg erecta random sequence Database(Ler) ftp://ftp.tigr.org/pub/data/a_thaliana/Ler/Ler_19991208 File: TIGR_Ler_19991208.fas.htm >Contig1 493 844 CTTTTGCTTTGTGTCTTCTAACAAGGATACAATTCTTACGCCTTTAAGATCCAATTGCAG TTTTAGTTCTTATACTCAATCATACACATGACATCAATTCATATTCGACTCCAAAACACT AACCAAGCTTCTTCTAGCTTCTCAAAGCTTTCATGGTGTAGCCAAAGTCTGTATGATTCT TTGGCTTTGTATCTTCTAACAAGGAAACACTACTTAGGCTTATAAGATTGGGTTGCGGTT TAAGTTCTTATACTAAATCATACATATGACATCAAGTCATATTCGACTCCAAAACACTAA CCAACCTTCTTCTTGCTTCTCAAAGCTTTCATGGTTTAGCCAAAGTCCATA … >Contig4556 116 570
Database record for an SSR SSR: GCA210 -> Contig742,GCA,12,GCA210 GCAGCAGCAGCA CCATCTTGTTCCGCCACCAGTGACGTGTACTCACCATCATATGACACCTG GTAGCAGTAGTGGTAGTAGCCTGATGAAAGGGTGTTGCTATTCTTGTTT
Primer (from Primer3) for SSR MARKER_NAME=Contig742GCA210 SEQUENCE=CCATCTTGTTCCGCCACCAGTGACGTGTACTCACCATCATAT ... TARGET=50,12 PRIMER_PAIR_PENALTY=0.9282 PRIMER_LEFT_PENALTY=0.817154 PRIMER_RIGHT_PENALTY=0.111077 PRIMER_LEFT_SEQUENCE=GCCACCAGTGACGTGTACTC PRIMER_RIGHT_SEQUENCE=AGCAACACCCTTTCATCAGG PRIMER_LEFT=12,20 PRIMER_RIGHT=100,20 PRIMER_LEFT_TM=59.183 PRIMER_RIGHT_TM=60.111 PRIMER_LEFT_GC_PERCENT=60.000 PRIMER_RIGHT_GC_PERCENT=50.000 PRIMER_LEFT_SELF_ANY=4.00 PRIMER_RIGHT_SELF_ANY=3.00 PRIMER_LEFT_SELF_END=4.00 PRIMER_RIGHT_SELF_END=1.00 PRIMER_LEFT_END_STABILITY=5.4000 PRIMER_RIGHT_END_STABILITY=8.2000 PRIMER_PAIR_COMPL_ANY=4.00 PRIMER_PAIR_COMPL_END=1.00 PRIMER_PRODUCT_SIZE=89
……next steps…… Use SSRs in db Experimental Rate the effectiveness Determine if we can predict ratings from SSR/primer pairs
References Skaletsky. H. et al.,Primer3 release 0.6, Whitehead Institute for Biomedical Research. http://www-genome.wi.mit.edu/ftp/distribution/software/README.primer3_0_6 Giraudat, et al., EMBO Practical Course on Genetic and Molecular Analysis of Arabidopsis. Module 2, French National Center for Scientific Research (CNRS) , http://www.cnrs-gif.fr/isv/EMBO/manuals/ch2.pdf (April 11, 2001) Mc Clintock, B. 1951. Chromosome organization and genic expression. Cold Spring Harb. Symp. Quant. Biol. 16:13-47. McClean, P, Transposon Tagging, NDSU 2000 - North Dakota State University, http://www.ndsu.nodak.edu/instruct/mcclean/plsc731/transposon/tag4.htm (March 23, 1998) Wolfgang Lukowitz et al. , Positional cloning in Arabidopsis. Why it feels good to have a genome initiative working for you. Plant Physiology, July 2000, Vol.123, pp. 795-805 Castelo, A., Tandem Repeat Occurrence Locator, SourceForge , http://finder.sourceforge.net (April 17, 2001) Promega Corporation, New Approaches to DNA Fingerprint Analysis, Promega Corporation Home Page, http://www.promega.com/pnotes/58/5189c/5189c.html?/pnotes/58/5189c/5189c.html, (May 16, 2001)