1 / 22

Grapevine breeding for resistance to downy and powdery mildew at the University of Udine

The University of Udine in Italy leads a project aiming to develop grapevine varieties resistant to downy and powdery mildew, reducing reliance on harmful pesticides in viticulture. Through a comprehensive breeding program, advanced evaluations, and marker-assisted selection, the project seeks to enhance grape quality and sustainability. Collaboration with global institutes ensures cutting-edge research and the preservation of traditional viticulture practices.

dianaheller
Télécharger la présentation

Grapevine breeding for resistance to downy and powdery mildew at the University of Udine

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Grapevine breeding for resistance to downy and powdery mildew at the University of Udine UNIVERSITY OF UDINE, ITALY Enrico PETERLUNGER, Gabriele DI GASPERO, Simone CASTELLARIN, Raffaele TESTOLIN Department of Agricultural and Environmental Sciences ___________________________________________ Project INNOWINE kickoff, June 21°, 2012, Novi Sad

  2. Modern viticulture is depending strongly upon pesticides.

  3. Vineyards in Europe on • 3.3% of total agricultural land but to preserve the grapes it is applied 65% of all fungicides used in agriculture, farmers damage for - man consumers - environment - economy of the crop

  4. Fungicide consumption in France Fungicides (France)‏ 45000 40000 35000 30000 Cereales 25000 Grapevine 20000 Other crops Tonnes de matières actives 15000 10000 5000 0 1992 1993 1994 1995 1996 1997 1998 1999 Years

  5. How did all this start?

  6. Most cultivated grape varieties are > 200 years old • Minimum contribution from breeding • Limited variability, also reduced by clonal selection • Plants and their pathogens co-evolute in a continous struggle for life • one species not able of reproduction is destined to succumb • Man can help that species to survive but such a choice has a cost ...........

  7. A brief hystory • from North America • Phylloxera 1878 • Powdery mildew 1845 • Downy mildew 1868

  8. Phylloxera  grafting onto resistant rootstocks •  breeding for resistant rootstock • PM, DM  breeding for • resistant cultivars, • hybrids such as • Isabella, Noah, • Clinton, Baco…

  9. but… • Resistancewas achieved • Quality was not satisfactory • About 1960 Europe decided to ban hybrids • except… • eventual new selections “comparable” • to vinifera

  10. Sources of resistance to diseases •  30 American species (V. riparia, V. rupestris, Muscadinia ) •  30 Asian species (V. amurensis, …) • monogenic (non-host, HR) • poligenic

  11. origin of sources of resistance Powdery mildew (ren1) Kishmish vatkana Downy mildew Powdery mildew Downy mildew Powdery mildew?

  12. the breeding lines susceptible (S) resistant (R) Chardonnay Bianca Cabernet S. 20/3 Merlot Regent Sauvignon Seyval Sangiovese Pannonia Tocai SK-00-1/2 ... ...

  13. Demasculation and controlled pollination

  14. The workplan • 800+ accessions introduced into the repository • 270 + cross combinations • 16.000+ seedlings under evaluation • Selection for - resistance • - agronomical features • - quality of musts

  15. advanced evaluation • nano-vinification of > 200 selections at UIV (VR) • wine testing for up to three years • advanced evaluation for 15 selections at VCR in Fossalon [2010]

  16. several advanced selections Vc 80.024 Vc 55.084 Vc 80.111 Vc 34.004 Vc 80.100 Vc 55.100 tocai x bianca sauv x bianca tocai x bianca tocai x 20/3 tocai x bianca sauv x bianca Vc 58.083 Vc 32.078 Vc 31.125 Vc 31.122 Vc 57.001 cab s x bianca cab s x 20/3 merlot x 20/3 merlot x 20/3 merlot x bianca

  17. Future development of the breeding program to combine together more than one resistence • combining resistences to different pathogens • combining more resistences to the same pathogen • 2 sources of resistance to downy and 2 to powdery mildew • to differentiate the product • sparkling base • long-lasting wines • dessert wines • table grape • ...

  18. The new frontiers of selection:the marker-assisted selection - Genome sequencing - No GMO - The selection is not carried out on phenotypic characters but on genes controlling them (e.g. resistance) X GTACGG GTACGT GTACGGGTACGTGTACGGGTACGTGTACGGGTACGGGTACGTGTACGG

  19. The new frontiers of selection:the selection for the aromatic profiles bianca chardonnay

  20. The impact of traditional viticulture needs to be considered • A more healthy viticulture with lower production cost can be done, • without forgetting tradition

  21. The value of our products • is the territory, • with our tradition • and skills • A resistant cultivar • can help future viticulture • to be more sustainable

  22. Research conducted in cooperation with • IGA- INSTITUTE OF APPLIED GENOMICS - Udine • and • Institute of Viticulture, Pécs, Hungary • Missouri State University, USA • INRA, Colmar, France • Université de Strasbourg, France • Genoscope, Paris, France • Institut für Rebenzüchtung, Geilweilerhof, Germany • University of Geisenheim, Germany • Unione Italiana Vini, Verona, Italy • University of Verona, Italy • CRA Istituto di Viticoltura, Conegliano, Italy • Support from • Region Friuli Venezia Giulia • MiPAF Projects Vigna & Vigneto • MiUR strategic projects PRIN • Vivai Cooperativi di Rauscedo • Banche di Credito Cooperativo of FVG • CR of Udine, Gorizia, Trieste • Consorzio Collio • Winemakers Felluga L, Felluga M, Zamò, Venica Thanks for your attention!

More Related