1 / 23

Locating and sequencing genes

Locating and sequencing genes. DNA probes. Used to locate a specific gene sequence / gene A short, single stranded section of DNA… Labeled with… What do you think a probe could be labeled with?

dianne
Télécharger la présentation

Locating and sequencing genes

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Locating and sequencing genes

  2. DNA probes • Used to locate a specific gene sequence / gene • A short, single stranded section of DNA… • Labeled with… • What do you think a probe could be labeled with? • Radioactive isotope – nucleotides are made using 32P phosphate. The radioactivity is detected using a photographic plate i.e. you can see where the probe is, and therefore can locate where the gene is… • Or the probe can be labeled with… • Fluorescent chemical – which emits light under certain conditions

  3. How do DNA probes work…? • The probe contains bases which are complimentary to the DNA sequence you want to find… • The DNA being tested is heated to separate the strands… • The single-stranded probe is mixed with the denatured DNA… • What then happens? • The probe hybridizes to the gene you want to find • The site where the probe binds can then be identified using…? • …the radioactivity or fluorescence that the probe emits

  4. DNA sequencing • But, how do we know what nucleotides / bases to make the probe out of? • We need find out the sequence of nucleotides / bases in the gene you are trying to locate… • Various methods… • E.g. Sanger method • Remember: Sanger used for sequencing

  5. Sanger method of DNA sequencing • Uses modified nucleotides that cannot attach to the next base in the sequence… • These are know as Terminators… • They end the synthesis of a DNA strand • Four different terminator nucleotides are used… • Why four? • One containing Adenine, one with Thymine, one with Guanine, one with Cytosine…

  6. Sanger method continued… • Set up four tubes, each containing… • Many single-stranded fragments of the DNA to be sequenced • A mixture of nucleotides, representing each of the 4 bases • A small amount of ONE of the four terminator nucleotides • Test tube 1 = adenine terminator nucleotide • Test tube 2 = thymine terminator nucleotide etc, etc • A primer, labeled with a radio-isotope or a fluorescent dye • DNA polymerase • Why is a primer needed? • To start DNA synthesis • Why is DNA polymerase needed? • To catalyse DNA synthesis once it has begun

  7. Sanger method continued… • The binding of nucleotides to the DNA fragments is random, so… • …the binding of a normal nucleotide is as likely as the binding of a terminator nucleotide. • So how long will the newly synthesized DNA be? • Depending where the terminator nucleotide binds on the DNA fragment… • …DNA synthesis may be terminated after a few nucleotides (so, short) , or… • …after a long fragment has been synthesized.

  8. Sanger method continued… • Therefore the DNA fragments in each test tube will be of varying lengths. • But they all have one thing in common… • …all the fragments of new double-stranded DNA in a particular test tube will each end with a nucleotide that has the same base e.g A in tube 1, T in tube 2 etc. • How can these fragments be identified? • Because of the labeled primer • The fragments now need to be separated…

  9. Sanger method continued… • DNA has a negative charge. Why? • Because of all the phosphate groups • Therefore DNA can be separated using… • …Gel Electrophoresis • The DNA fragments are applied to agar gel • A voltage is applied across the gel • Which fragments move the furthest / least far? • The smallest / the biggest • A photographic plate is laid on the gel for several hours. Why? • The Radiolabeled fragments expose the film and so reveal their location

  10. Loading the electrophoresis gel

  11. Sanger method results…

  12. These are the terminator nucleotides Interpreting the results… • From where should you read the results? • From the top down • Why? • Because the shortest fragments move the longest distance. • So, what is the first base in the fragment? • C • Then what ? • T • What’s the full sequence? • CTTGATCTTCATGGTAGGCCT… etc • What’s the sequence of the gene (not the DNA you’ve just made)? • GAACTAGAA… • ie. The complimentary base sequence! Short fragments of DNA Increasing distance from the origin Long fragments of DNA

  13. Video clips • http://www.youtube.com/watch?v=aPN8LP4YxPo Explains the process nicely. • http://www.youtube.com/watch?v=6ldtdWjDwes Does not explain the process very well but shows how you arrive at the final sequence.

  14. Restriction mapping • Sanger sequencing can only be used for fragments of DNA up to 500 bases long. • Before sequencing, larger genes and entire genomes must first be cut into smaller fragments. How? • Using restriction endonucleases • The fragments must then be separated. How? • Using gel electrophoresis • And then each fragment is sequenced separately • Then what? • The sequenced fragments have to be pieced back together. This is called restriction mapping

  15. Restriction mapping uses… • Restriction endonucleases, which cut DNA at recognition sites • The DNA to be sequenced is cut using a series of different endonucleases. • How can the distance between the recognition sites can be determined? • By the pattern the fragments make on the gel • An example is explained on page 269 of Nelson Thornes

  16. Restriction mapping • E.g… of a plasmid with 100,000 bases (100kb)… • Plasmids are circular, so if only one restriction endonuclease were used what would be the product? • A single piece of DNA which is 100kb long, regardless of which enzyme were used. • But what if more than one restriction enzyme were used? • There will be two cuts to the plasmid and so two different length fragments will be produced • Always? • It is possible that the two enzymes make cuts 180degrees around the plasmid from each other, so that each fragment is exactly half of 100kb i.e. 50kb

  17. Possible gel electrophoresis results of 3 different restriction mapping “double digests” The numbers are the lengths of the fragments produced by the enzymes in kilobases • Why do the numbers in each column add up to 100? • Because the original plasmid was 100kilobases big • If the table was a gel, in what direction did the fragments move? • From top to bottom (10kb migrates further than 90kb)

  18. Restriction map for an E. coli Cloning Vector Plasmid • This restriction map shows the recognition sites of various endonucleases. • The map also shows the antibiotic resistance marker genes. • Genes to be cloned can be inserted into numerous places depending on the restriction endonuclease used • Look at the positions of BamHI and HindIII… • Assuming the plasmid was 100kb, what size fragments would a double digest with these two enzymes produce? • 10kb & 90kb…

  19. Videoclip • Admittedly the delivery is fairly boring… • But it is spot on in terms of content! • http://www.youtube.com/watch?v=c97VqOJkQ88 Video shows how to use the results of restriction mapping.

  20. Automation • Both DNA sequencing an restriction mapping are now routinely automated and… • computers are used to analyse the results. • The machines use… • 4 different fluorescent dyes to label the terminators, one for each kind (radiolabeled primers not used) • The DNA synthesis occurs in a single test tube (not 4)… • And PCR is used to speed it up. • The electrophoresis occurs in a narrow capillary gel • The results are red by lasers • Also, prior to digestion with endonucleases, PCR is used to provide the fragments needed at the start • Think: Cost Benefit Analysis? Expensive but quick, accurate

  21. Questions • What is a DNA probe? • State TWO roles of a primer used in the Sanger method of DNA sequencing • Describe gel electrophoresis? • What is meant by the term “restriction map” • List the differences between the original manual method of restriction mapping, and the current automated version

  22. Implications of Genetic Screening • With information comes power, opportunity and responsibility… • Who decides who should be screened? It’s expensive and budgets are limited • Who has access to the test results? Employers? Insurers? Lenders? • Does a carrier have a responsibility for the alleles they pass on? Note – the genetic disease Tay-Sachs involves constant pain and death at the age of four years • Does mankind have a responsibility to maintain genetic diversity? Should we preserve mutant genes for the sake of human evolution? • Who decides what is a defect? Tay-sachs, yes, but ginger hair…?

More Related