dillan
Uploaded by
37 SLIDES
547 VUES
370LIKES

Using DNA Microarrays from Multiple Species:  Comparisons for Teaching Effectiveness

DESCRIPTION

Using DNA Microarrays from Multiple Species:  Comparisons for Teaching Effectiveness. Todd T. Eckdahl Biology Department Missouri Western State College. Overview. Background Courses using microarray technology Species studied Implementation Results Planned research projects.

1 / 37

Télécharger la présentation

Using DNA Microarrays from Multiple Species:  Comparisons for Teaching Effectiveness

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Using DNA Microarrays from Multiple Species:  Comparisons for Teaching Effectiveness Todd T. Eckdahl Biology Department Missouri Western State College

  2. Overview • Background • Courses using microarray technology • Species studied • Implementation • Results • Planned research projects

  3. Missouri Western State College • Saint Joseph, Missouri • State-supported PUI • ~5200 students • 200 faculty • Biology Department • ~340 majors • 10 faculty • No graduate degree programs • New major in Biochemistry and Molecular Biology

  4. Courses Using Microarray Technology • BIO 431 Molecular Biology • 4 credit course • 3 hours lecture, 3 hours lab • Student majors • BMB, Biology with Health Sciences emphasis • BIO 313 Topics in Molecular Genetics • 1 credit course • 3 hours lab • Student majors • BMB, Biology-Health Sciences, Teaching

  5. Functional Genomics Technology • Microarrays • cDNAs printed • eg. Stanford yeast chips, UW E. coli chips • 80-mer oligos printed • eg. ISB yeast chips • Labeling options • Indirect labeling • eg. Genisphere dendrimers • Direct incorporation • eg. Ulysis alexafluore labeling

  6. Conducting Microarray Experiments in a Course • Emphasize the “Big Picture” • Genomics, functional genomics, proteomics • Shift to data-rich science • Primary Literature • Brainstorming for ideas • Scheduling • Data Analysis • Presentations

  7. Ideas for Yeast Experiments • Glucose vs. Galactose vs. Fructose vs. Maltose • Anaerobic vs. aerobic • Induction of sporulation • Heat Shock v. Cold Shock • Drug treatment

  8. Minor Groove Binding Drugs • Anti-tumor properties • Conformational change in the 3D structure of DNA • Prior Knowledge of MGBD/DNA interaction • As models for minor groove binding proteins DAPI

  9. Yeast Culture • ODat 660 nm to measure turbidity • Grown through log phase • 4 hours of exposure to 10 uM DAPI • Control culture without DAPI

  10. Isolation of RNA • Sterile, RNase- free equipment and workspace • Harvesting of yeast • Production of spheroblasts • Isolation of RNA via RNA spin column • Elution of RNA • Quantify RNA with A260 / A280 • Run RNA on denaturing agarose

  11. Preparation of labeled cDNA and hybridization • Reverse transcription of RNA • capture sequence incorporated • Label preparation • addition of Cy3 and Cy5 dendrimer • addition of capturing reagents • Add probe to slide, cover and incubate at 55 C for 1-3 days

  12. Experimental Summary Yeast in log phase untreated 10 uM DAPI Total RNA Total RNA Reverse Txn cDNA cDNA Red fluorophore Green fluorophore microarray hybridization

  13. Data Acquisition • Post-hybe wash, dry slide • Ship for scanning • Receive data • Scanalyze • Submit to SMD

  14. Microarray Controls • Empty or 3X SSC • Duplicate genes • Duplicate experiments • Cy3 and Cy5 dyes • Poly A • Genomic, Intron, tRNA

  15. Example of induced gene YBR012W-B, TyB Gag-Pol protein TGAGAAGCTGTCATCGAAGTTAGAGGAAGCTGAAGTGCAAGGATTGATAA TGTAATAGGATAATGAAACATATAAAACGGAATGAGGAATAATCGCAATA TTAGTATGTAGAAATATAGATTCCATTTTGAGGATTCCTATATCCTCGAG GAGAACTTCTAGTATATTCTGTATACCTAATATTATAGCCTTTATCAACA ATG

  16. Example of repressed gene YHR055C, copper-binding metallothionein TTCCGCTGAACCGTTCCAGCAAAAAAGACTACCAACGCAATATGGATTGT CAGAATCATATAAAAGAGAAGCAAATAACTCCTTGTCTTGTATCAATTGC ATTATAATATCTTCTTGTTAGTGCAATATCATATAGAAGTCATCGAAATA GATATTAAGAAAAACAAACTGTACAATCAATCAATCAATCATCACATAAA ATG

  17. Analyses at Stanford Microarray Database • Single spot or sequence • Data filtering • signal strength • R/G or G/R ratio • Linear regression comparison • Prepare data for clustering

  18. Databases linked to SMD • SGD - Saccharomyces genome database • Genbank • YPD - yeast protein database • Swissprot protein database

  19. Ideas for E. coli Experiments • Metabolic shift • Osmotic stress • Growth curve effects • Heat Shock v. Cold Shock • Drug treatment • Effects of gene deletion

  20. BIO 313 Experiment • E coli chips • M1655 sequenced strain • cDNA spotted • Putative transcriptional regulators • nusA deletion strain • yhbM deletion strain • Two channel hybridizations • Compare labeled RNA from wt versus deletion

  21. E. coli culture • Overnight culture • Grown at 37°C to log phase • OD at 600 nm to measure turbidity

  22. RNA Isolation • Sterile, RNase-free equipment and work area • Total RNA SafeKit • Total RNA Safe protocol used • Lysis of E. coli done with mixture of TE and lysozyme

  23. RNA Isolates • Measure A260 / A280 • Check on denaturing agarose gel

  24. Labeling • Labeling of isolated RNA done by use of ULYSIS Nucleic Acid Direct Labeling Kit • ULYSIS protocol followed • Fluorescent Dyes: Alexa Fluor 546 (green) and Alexa Fluor 660 (red)

  25. Hybridization • Microarray prehybridized • Labeled RNA mixed together in hybridization buffer and added to slide • Hyb at 55 C in dry incubator overnight • Post-hyb washes

  26. Microarray Controls • Empty or 3X SSC • Duplicate genes • Duplicate experiments • Cy3 and Cy5 dyes • Genomic

  27. Examples of Results asrflhCemrY

  28. Examples • Induced • Asr, G1787881 • acid shock protein • Repressed • flhC, G1788201 • regulator of flagellar biosynthesis acting on class 2 operons • Non-responsive • emrY, G1788710 • multidrug resistance protein Y • putative transport

  29. Example of induced gene Asr, G1787881 gatca agactactattattggtagctaaatttcccttaagtcac aatacgttattatcaacgctgtaatttattcagcgtttg tacatatcgttacacgctgaaaccaaccactcacggaag tctgccattcccagggatatagttatttcaacggccccg cagtggggttaaatgaaaaaacaaattgagggtatgaca 1 - atg aaa aaa gta tta gct ctg gtt gtt gcc 31 - gct gct atg ggt ctg tct tct gcc gcc ttt 61 - gct gca gag act acg acc aca cct gct ccg 91 - act gcg acg acc acc aaa gca gcg ccg gcg

  30. Example of repressed gene flhC, G1788201 ccgca aatggttaagctggcagaaaccaatcaactggtttgtca cttccgttttgacagccaccagacgattactcagttgac gcaagattcccgcgttgacgatctccagcaaattcatac cggcatcatgctctcaacacgcttgctgaatgatgttaa tcagcctgaagaagcgctgcgcaagaaaagggcctgatc 1 - atg agt gaa aaa agc att gtt cag gaa gcg 31 - cgg gat att cag ctg gca atg gaa ttg atc 61 - acc ctg ggc gct cgt ttg cag atg ctg gaa 91 - agc gaa aca cag tta agt cgc gga cgc ctg

  31. Example of non-responsive gene emrY, G1788710 gaact catggaacaccccttgcgtattggtttatcgatgacagc aactattgatacgaagaacgaagacattgccgagatgcc tgagctggcttcaaccgtgacctccatgccggcttatac cagtaaggctttagttatcgataccagtccgatagaaaa agaaattagcaacattatttcgcataatggacaacttta 1 - atg gca atc act aaa tca act ccg gca cca 31 - tta acc ggt ggg acg tta tgg tgc gtc act 61 - att gca ttg tca tta gcg aca ttt atg caa 91 - atg ttg gat tcc act att tct aac gtc gca

  32. Microarrays in Courses:Lessons Learned • Advance planning essential • Controls for critical steps • Reliability and Reproducibility • Do Controls Make Sense? • Do Results Make Sense? • Potential for large amounts of data means extensive analysis time needed

  33. Ongoing and Planned Research Projects • Measure Effects of Minor Groove Binding Drugs on Gene Expression in Yeast • Measure Effects of Minor Groove Binding Drugs on Gene Expression in Human Tumor Cells in Culture

  34. Big Ideas • Sequence and structural requirements for MGBD binding • A+T rich sequences • DNA bending • Determination of optimal binding sites • Effects of MGBDs on gene expression • Preliminary data using RT-PCR • Global patterns of gene expression • Complementary in vitro and in vivo approaches

  35. Acknowledgements • Genome Consortium for Active Teaching • Malcolm Campbell, Davidson College • NSF DBI 0099720 MUE grant • Dr. Barbara Dunn, Stanford University • Dr. Fred Blattner lab, UW-Madison • Dr. Bob Getts, Genisphere, Inc. • Missouri Western Students

More Related