1 / 28

Making Sense of DNA

Making Sense of DNA. DNA is a code for making proteins. DNA (Gene)  Protein Trait. Dilemma. Protein Made by ribosomes Ribosomes stuck in cytoplasm. DNA Contains sequence for protein Risky/Dangerous for DNA to leave nucleus. Solution– SEND MESSENGER!. Step 1- Copy DNA Info on mRNA.

duard
Télécharger la présentation

Making Sense of DNA

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Making Sense of DNA

  2. DNA is a code for making proteins DNA (Gene) Protein Trait

  3. Dilemma Protein • Made by ribosomes • Ribosomes stuck in cytoplasm DNA • Contains sequence for protein • Risky/Dangerous for DNA to leave nucleus

  4. Solution– SEND MESSENGER!

  5. Step 1- Copy DNA Info on mRNA • DNA creates a message for the ribosome called mRNA. • Messenger RNA (mRNA): • Same structure as DNA (except different type of sugar; ribose instead of deoxyribose)

  6. Step 1- Copy DNA Info on mRNA • DNA creates a message for the ribosome called mRNA. • Messenger RNA (mRNA): • Same structure as DNA (except different type of sugar; ribose instead of deoxyribose) • Single stranded

  7. Step 1- Copy DNA Info on mRNA • DNA creates a message for the ribosome called mRNA. • Messenger RNA (mRNA): • Same structure as DNA (except different type of sugar; ribose instead of deoxyribose) • Single stranded • Uracil replaces all the thymines.

  8. Step 1- Copy DNA Info on mRNA • Write the corresponding RNA strand TAAGCTACCGAATGGACAACACTTCGACTA AUUCGAUGGUUACCUGUUGUGAAGCUGA

  9. Step 1- Copy DNA Info on mRNA • Transcription video • http://www.youtube.com/watch?v=ztPkv7wc3yU

  10. Step 1- Copy DNA Info on mRNA Similarities between DNA and RNA: 1. Sugar and phosphate make up the backbone 2. They both have base pairs 3. They both carry the same protein messages

  11. Step 2- mRNA leaves nucleus

  12. Step 3- mRNA attaches to ribosome at START codon (AUG) • Ribosome finds the START sequence in the mRNA: AUG

  13. Remember? • Ribosome- ___________________

  14. Remember? • Ribosome- makes protein

  15. Step 4- tRNA brings the correct amino acid

  16. Step 4- tRNA brings the correct amino acid • Each sequence of 3 bases corresponds to 1 amino acid • Codon- sequence of 3 bases that codes for an amino acid

  17. Step 4- tRNA brings the correct amino acid • Transfer RNA (tRNA)- brings amino acids to the ribosome.

  18. (Why sequence of 3?) • There are 20 common amino acids. • Could you make 20 different combinations with 2 bases? • How many different combinations can you make with 3 bases?

  19. Step 5- Amino Acids link to form Protein

  20. Step 5- Amino Acids link to form Protein • tRNA brings the next amino acid. • Peptide bonds- connect amino acids together to form a protein • Protein- chain of amino acids that fold into a specific shape.

  21. Step 6- tRNA reaches STOP codon • The process continues until the STOP codon: UAG, UAA, UGA • Then the protein is complete.

  22. Putting it all together • Video 1 • Video 2

  23. Ticket • How does the DNA code get to the ribosome? • Which amino acid would match the mRNA code: CCA?

  24. Short cut

  25. Practice DNA code: TACGTTCGAATT mRNA code: Amino acid code:

  26. Project-Based Assessment #3 Project choices: Cancer (any genes)

More Related