dulcea
Uploaded by
25 SLIDES
452 VUES
250LIKES

Reverse Genetics in Drosophila

DESCRIPTION

Reverse Genetics in Drosophila. I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations. II. RNA interference A. Basics of RNAi B. RNAi methods in flies. III. Targeted gene replacement. P element constructs.

1 / 25

Télécharger la présentation

Reverse Genetics in Drosophila

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II. RNA interference A. Basics of RNAi B. RNAi methods in flies III. Targeted gene replacement

  2. P element constructs enhancer trap: expresses bGal in same pattern as target gene enhancer target gene lacZ white

  3. GAL4 white GAL4 enhancer trap: expresses Gal4p in same pattern as target gene P element constructs controlled misexpression: expresses target gene in Gal4-dependent manner white UAS

  4. P element constructs insulators: block enhancers and position effects on expression white yellow

  5. Mapped P element Insertion Lines (Bloomington Stock Center, as of 11/12/02) P{PZ} enhancer trap 523 P{lacW} enhancer trap 1176 P{Gal4} Gal4 expression 141 P{EP} UAS-controlled expression 263 P{SUPor-P} insulator 2076 P{GT1} gene trap 511 4690

  6. dominant marker P transposase (chromosome 3) Sb D2-3 + w P{w+} Sb D2-3 ; w Y + screen for red-eyed sons w P{w+} ; Y + new insertion on autosome Transposition of P Elements w P{w+} P element on X chromosome

  7. P elements rarely insert into coding sequences Spradling et al. (1995)

  8. w P{w+} ; w Y Sb D2-3 w P{w+}** ; Y + screen for loss of w+, indicating excision Excision of P Elements dominant marker P transposase (chromosome 3) P element on chromosome 3 Sb D2-3 w ;P{w+} +

  9. 8-bp target site 31-bp P inverted repeat ...ATGCCAAACATGATGAAATAACATAAGGTGGTCCCGTCG... ...TACGGTTTGTACTACTTTATTGTATTCCACCAGGGCAGC... P transposase ...ATGCCAAACATGATGAAATAACATA ...TACGGTTT 17-nt 3’ overhang white P transposase

  10. (double-strand break) non-homologous end-joining homologous recombination different products, depending on: template for repair extent of repair gap widening before repair

  11. whi internal deletion of P element (w-) sometimes alters expression of target gene B. Repair using homologous chromosome as a template precise excision useful for proving that phenotypes are due to P element insertion A. Repair using sister chromatid as a template white restoration of P element (w+)

  12. exonuclease repair deletion of flanking DNA C. “Imprecise excision”

  13. Dicer endonuclease 21-23 bp (or nt) siRNA find complementary mRNA (RISC complex) destroy mRNA RNA Interference dsRNA

  14. Functions for RNA Interference Repression of repeated genes (e.g., transposable elements) Defense against viruses (plants) Developmental control of gene expression (small temporal RNAs) X chromosome inactivation (mammals) Silencing of mating type loci and centromeric regions (S. pombe) DNA elimination in macronuclei (Tetrahymena) Experimental manipulation of gene function.

  15. UAS Gal4 RNA dsRNA RNAi Methods in Drosophila 1. Addition of dsRNA to cell culture 2. Injection of dsRNA into embryos 3. Expression of hairpin RNA in vivo.

  16. S. cerevisiae Generate linear targeting DNA by PCR Transform suitable strain Plate on medium for positive selection (10-8?) M. musculus Generate targeting DNA by cloning, cutting Transform ES cells Conduct positive and negative selections (typical = 10-7) Gene Targeting Technologies

  17. Solution (Rong and Golic) Generate linear DNA in vivo: Obtain stable transformants of donor construct Use FLP – FRT system to excise donor DNA from chromosome Use I-SceI to linearize donor DNA Use visible marker gene to screen for potential homologous gene replacements Gene Targeting in Drosophila Problems No culture system for germline stem cells DNA introduced by injection in single embryos Existence of DNA repair in early development questionable

  18. FLP recombinase crossover FLP Recombinase Catalyzes Exchange Between Target Sequences (FRTs) FRT

  19. extrachromosomal circle with 1 FRT chromosome with 1 FRT Intrachromosomal Recombination Between Tandem FRTs Results in Excision from the Chromosome FRT FRT

  20. I-SceI 5' ATTACCCTGTTAT CCCTAAATT 3' 3' TAATGGGAC AATAGGGATTTAA 5' I-SceI makes a double-strand break at an 18-bp target sequence 5' ATTACCCTGTTATCCCTAAATT 3' 3' TAATGGGACAATAGGGATTTAA 5'

  21. FLP recombinase extrachromosomal circular donor FRT FRT I-SceI site donor construct (integrated P element)

  22. I-SceI endonuclease DSB * integration * tandem duplication

  23. FLP recombinase I-SceI endonuclease * integration * w+ * w+

  24. I-CreI endonuclease * w+ DSB Repair of a DSB between direct repeats * Tandem Duplications can be Reduced to Single Copy I-CreI site * w+

  25. Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II. RNA interference A. Basics of RNAi B. RNAi methods in flies III. Targeted gene replacement

More Related