710 likes | 713 Vues
This study explores the global evolution and adaptation of Vibrio cholerae, the bacterium responsible for cholera. It examines the genomic variations and annotations, as well as the multiple pandemics and outbreaks of the disease. The findings shed light on the origins and spread of cholera in different regions and help identify important genes for temporal and spatial variations.
E N D
Flinders 2015 The Global Evolution and Adaptation of Vibrio cholerae Across Multiple Niche Dimensions Rob Edwards
Flinders 2015 How to annotate a couple of hundred genomes Rob Edwards
Annotation of microbial genomesand comparison across differences • Cholerae • Haiti • Genome Sequencing • ORF Calling • Annotation • Global evolution • Niche dimensions
A world wide pandemic • About 3-5 million cases per year • About 100 - 200,000 deaths world wide per year • Notable deaths: • Tchaikovsky • Polk (11th President USA)
Symptoms • About 75% of patients have no symptoms • 25-50 PINTS of diarrhea per DAY • Severe symptoms are by dehydration • Treatment • Clean water • Electrolytes • Vaccine • Not antibiotics
Multiple Pandemics • 1st – 1817 to 1823 Started at the Ganges, spread by colonialists • 2nd – 1829 to 1849 Worldwide spread via immigrants • 3rd – 1852 to 1859 John Snow first epidemiologist
First epidemiological study • John Snow • Portrait painted in • 1847 when he was • 34 years old.
First epidemiological study • John Snow • Cholera outbreak in Soho, London 1854 • Plotted all cases on a map • Found big cluster around water well
First epidemiological study John Snow’s Map
Cholera caused by bacteria Outbreaks of cholera
Multiple Pandemics • 1st – 1817 to 1823 Started at the Ganges, spread by colonialists • 2nd – 1829 to 1849 Worldwide spread via immigrants • 3rd – 1852 to 1859 John Snow first epidemiologist • 4th – 1863 to 1879 Originated in mecca • 5th – 1881 to 1896 First cholerae vaccine (1892) • 6th – 1899 to 1923 Killed 800,000 people • 7th – 1961 to present • 1991: South America killed > 100,000 people
Haitian Outbreak • Earthquake Jan 12th, 2010 • No cholera in Haiti for > 50 years • First case, October 22nd, 2010 • By February, 2011 250,000 cases and ~5,000 deaths • What was the original source?
Haitian cholera outbreaks http://www.ph.ucla.edu/
Source: Final Report of the Independent Panel of Experts on the Cholera Outbreak in Haiti
Haitian Outbreak • Two hypotheses: • Endemic, waterborne strain that has been in Haiti but not caused disease for 50 years • Imported from another country
The environmental hypothesis "They have been fortunate in Haiti that for 50 years the conditions have been such that they haven’t had an intense increase in cholera bacterial populations. ... But they’ve had an earthquake, they’ve had destruction, they’ve had a hurricane ... I think it’s very unfortunate to look for a scapegoat. It is an environmental phenomenon that is involved” Rita Colwell Johns Hopkins School of Public Health
The human hypothesis “The organism that is causing the disease is very uncharacteristic of (Haiti and the Caribbean), and is quite characteristic of the region from where the soldiers in the base came. ... I don't see there is any way to avoid the conclusion that an unfortunate and presumably accidental introduction of the organism occurred." John Mekalanos Harvard Medical School
Conditions favor human hypothesis Source: Final Report of the Independent Panel of Experts on the Cholera Outbreak in Haiti
Conditions favor human hypothesis Source: Final Report of the Independent Panel of Experts on the Cholera Outbreak in Haiti
Conditions favor human hypothesis Source: Final Report of the Independent Panel of Experts on the Cholera Outbreak in Haiti
Global evolution of Vibrio Can we use genomics to identify the global evolution of Vibrio? Which gene(s) are important for temporal/spatial variation?
Prototype Vibrio cholerae sequence TIGR Nature 406, 477-483(3 August 2000)
Sequenced genomes 2011 – 32 Vibrio strains sequenced
Sequenced genomes 2011 – 171 Vibrio strains sequenced 2011 – 32 Vibrio strains sequenced
The steps in genome sequencing • Generate genome sequence • Assembly • ORF calling • tRNA identification • rRNA identification • Functional annotation
Putative protein • Open Reading Frame (ORF) • A stretch of amino acids with no stop codon • Coding Sequence (CDS) • An ORF that could encode a protein • Protein encoding gene (PEG) • An ORF that could encode a protein • Hypothetical protein = putative protein • Something that has not been experimentally shown • Polypeptide • Short stretch of ~50 amino acids. Often a domain
Single nucleotide polymorphisms ATCATCGATCAGCATGCATCAGCATCGATCAGC ATCATCGATCAGCATGCATCAGCATCGATCAGC ATCATCGATCAGCATGCATCAGCCTCGATCAGC ATCATCGATCAGCATGCATCAGCCTCGATCAGC ATCATCGATCAGCAAGCATCAGCCTCGATCAGC ATCATCGATCAGCAAGCATCAGCCTCGATCAGC ATCATCGATCAGCAAGCATCAGCCTCGATCAGC ATCATCGATCAGCAAGCATCAGCCTCGAGCAGC ATCATCGATCAGCAAGCATCAGCCTCGAGCAGC
Global evolution Mutreja et al 2011
Waves of spread of cholera Mutreja et al 2011
Different evolution for each wave Mutreja et al 2011
On the source of Haitian cholera Vibrio cholerae from Bangladesh in 1994 Vibrio cholerae from Haiti in 2010 Vibrio cholerae from Bangladesh in 2002 Vibrio cholerae from Haiti in 2010 Vibrio cholerae from Haiti in 2010 Harveyi Parahemolyticus Mimicus Cholerae
Nepalese soldiers? Outbreak in Khatmandu, Nepal before the soldiers left Outbreaks downstream (not upstream) along the river from the nepalese UN camp But that could have come from river trade. Ships used to fly the yellow flag when they were quarantined by cholera