Distribution and Characterization of Fungal Endophytes in Piñon Trees of Southwest Woodlands
10 likes | 140 Vues
This study investigates the wood-associated fungal communities in piñon trees (Pinus edulis) within piñon-juniper woodlands in the Southwest, particularly those impacted by drought and bark beetle infestations. By analyzing healthy and damaged trees at the Sevilleta National Wildlife Refuge, we identified various fungal genera, including Pleosporales and Ophiostoma, using molecular sequencing techniques. Our findings highlight the role of fungal endophytes in tree health and stress response, providing insights into potential pathogens and ecological dynamics driven by climate factors.
Distribution and Characterization of Fungal Endophytes in Piñon Trees of Southwest Woodlands
E N D
Presentation Transcript
FUNGAL MOLECULAR ECOLOGY LAB Abstract Distribution of the Most Abundant Fungal Endophytes Distribution of All Isolates Based on Order Piñon trees in piñon-juniper woodlands in the Southwest have been showing increase mortality due in part to major droughts that have been impacting this area. However, it is unclear if drought-induced morality is the sole cause. Under stress conditions, piñon trees are commonly attack by bark beetles (Ipsconfusus) and blue-stain fungi (Ophiostoma sp.). We described wood-associated fungal communities isolated from cores of healthy and bark-beetle damage trees. Samples were taken from healthy and dying piñon from experimental plots in a piñon-juniper woodland at the LTER site in the Sevilleta National Wildlife Refuge, NM. The experiment utilizes different treatments: excluding 50% of ambient precipitation, 150% mean annual precipitation, exclusion control and environmental controls. Cores were taken from trees, surface sterilize, cut into 1-2 cm sections and plated on PDA (potato dextrose agar) with antibiotics. Isolates were sequenced using the ITS rDNA barcode region. An approximate total of 155 unique sequences were obtained. The wood endophytic communities were dominated by Pleosporales, Dothidiales and Xylariales. Common genera include Penicillium, Hormonema and Pestalotiopsis. Fungi within the genus Ophiostoma were also recovered from bark-bettle damage trees. This initial characterization of wood-isolated fungi will help document potential dormant pathogens and changes in community with the arrival of blue-stain fungi due to insect attack. Isolation of Fungi from Healthy and Blue-Stain Infected Piñon at the Sevilleta LTER Zachary T. Gossage1, Joanna Redfern2, Paulette Ford3, William Pockman2, Nate McDowell4, Donald Natvig2,Andrea Porras-Alfaro1, 2, Department of Biological Sciences1. Western Illinois University, 2. University of New Mexico, 3. Forest Service, 4. Los Alamos National Lab Sydowiapolysporawas the most common fungal endophyte isolated from twigs, needles and insects. Roots were mainly colonized by a fungus related to Penicillium. Multiple species of Alternaria and Pestalotiopsis were also found in needles and twigs. Ascomycota was the dominant phylum found in P. edulis. At the order level, Dothidiales, Pleosporales and Xylariales are the dominant taxa colonizing twigs, and needles. Roots were mainly colonized by fungi in the Eurotiales and Hypocreales. These orders include a number of fungal pathogens and known endophytic fungi. Preliminary analysis of fungal sequences using BLAST Three mortality in the southwest Beshers et al. 2005 measured mortality rates of trees in soil depleted of water after 15 months of drought conditions. Extensive mortality was shown, exceeding 90 percent of Pinusedulis. A relationship among drought, bark beetles (a known pathogen), and fungi was recognized with later research. Methods: Experimental Plots: Precipitation Exclusion Added Precipitation Exclusion Control Environmental Control Examine (Allen 2007) Living Trees Dead Trees Most Abundant Endophytes Blue stain fungi- the plant pathogen: Ophiostoma sp. Sampling from: Pestalotiopsis sp. >AM427_2 3.1 (sequenced obtained from an insect) CGCGCCTCTCCCCCCCAGGTCCCTTCGGGGCGCCCGCCAGCGGCCGCGAG CCGCCCGAACCTCTTATAAACCGTAACCGAACCGTCTGAGAAACAAACAA AAACAGCCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAA GAACGCAGCGAAATGCGATACGTAATGCGAATTGCAGAATTCAGCGAGTC ATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGC CTGTCCGAGCGTCATTTCCCCCCTCAGCGCGCCCTTCTGGGAGCGCTGGC GTTGGGGCTCCTCCGCCCTCTGTGGCGGCAGGGCCCTCAAATCCAGTGGC GGGCCCGTCTGGCTGGCTCCGAGCGCAGTACCGAACGCAAGTTCTCCTCT CGCTTCGTAGCCCCGGCCGGCGCCCAGCCGTCAAGCCGCGCAGGCGACTC TTCCAGGGCCGCCTCGCACTTTTTTACAAGGTTGACCTCGGATCAGGTAG GACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA Sydowiapolyspora Ophiostoma sp. fruiting bodies Pestalotiopsis contains fungi that are very difficult to distinguish at the species level. They generally don’t show host-specificity. Most species have been identified as plant pathogens and the rest are saprobes or endophytic fungi (Wei 2004). S. polyspora, or Hormonemadematoides, is a known endophytic fungi. It has shown potential in producing medically important chemicals such as hormonemate (causes apoptosis) (Filip 2003). Also can be a pathogen causing tip dieback. Cores Leaves Roots Beetles Twigs (http://people.ucsc.edu/~ggilbert/images_lab/pestalotiopsis.jpg) Plated on Agar (Filip 2003) Multiple species of Ophiostoma have been shown to be plant pathogens and dubbed ‘blue-stain fungi’ due to the staining they cause on their host’s tissue. In a 2009 survey of the Piñon-Juniper woodlands in New Mexico, O. montiumand O. minus were isolated from dead or dying trees multiple times. Cultures Isolated Penicilliumcanescens Alternariaalternata Sequenced A. alternatais a known plant pathogen; causes blight in potatoes and leaf spot disease. This species has been shown to have seven pathotypes that produce host-specific toxins (R Hatta et. al 2002). P. canescenshas been shown to produce xylanase, which could be useful for industrial purposes (Bakri 2003). BLAST • Analysis of different types of fungi associated with different sources. (http://www.mycology.adelaide.edu.au/images/Alternariq.gif) (http://www.bcrc.firdi.org.tw/fungi/fungal_detail.jsp?id=FU200802260010) Piñon infected with Ophiostoma Acknowledgments This project is currently funded by Forest Service and an WIU URC Summer Grant , DOE and NSF Sevilleta LTER grant.