elina
Uploaded by
44 SLIDES
1398 VUES
450LIKES

Genetic Engineering

DESCRIPTION

Genetic Engineering. Topics. Concepts. Agrobacterium Gene gun Protoplasts Anti-sense technology. DNA code is universal Plants can be transformed with “foreign” DNA using one of several methods Antisense technology can eliminate a trait Successful genetic engineering

1 / 44

Télécharger la présentation

Genetic Engineering

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Genetic Engineering Topics Concepts • Agrobacterium • Gene gun • Protoplasts • Anti-sense technology • DNA code is universal • Plants can be transformed • with “foreign” DNA using one • of several methods • Antisense technology can • eliminate a trait • Successful genetic engineering • depends on a plant’s offspring • carrying the new gene Terms • Cloning • Agrobacterium • Plant hormones • Callus

  2. Damage done by Lepidoptera Corn borer Gypsy Moths Monarch Butterflies Cabbage Butterflies

  3. Bacillus thuringiensis is an effective biocontrol agent Intact bacteria Spore Bt-toxin helios.bto.ed.ac.uk/ bto/microbes/bt.htm

  4. Scientists have used genetic engineering to move the Bt-gene into plants

  5. CLONING • Cutting and splicing genes • Generating an exact copy • Cells • Organism (i.e potato)

  6. CLONING: 2 definitions • Cutting and splicing genes • Generating an exact copy - cells - organism (i.e. potato)

  7. Moving the Bt-gene into plants

  8. In nature, Agrobacterium carries a Tumor-inducing (Ti) plasmid Genomic DNA Ti-plasmid (tumor-inducing) Agrobacterium

  9. The Ti-plasmid carries Transfer DNA (T-DNA) T-DNA Plant promoter Plant hormone genes Opine Synthesis genes

  10. Agrobacterium delivers the Transfer DNA (T-DNA) to the plant cell Agrobacterium Plant Cell

  11. The Transfer DNA (T-DNA) integrates into to the plant DNA Agrobacterium Plant Cell

  12. The Transfer DNA (T-DNA) integrates into to the plant DNA Plant promoter Plant hormone and opine Synthesis genes Plant Cell

  13. Agrobacterium forces plant to become a opine factory http://helios.bto.ed.ac.uk

  14. In genetic engineering, scientists highjack the Ti-plasmid and clone the Bt-toxin gene into it Ti-plasmid Plant promoter Bt-toxin gene T-DNA

  15. The Transfer DNA (T-DNA) integrates into to the plant DNA T-DNA + Bt-toxin gene Agrobacterium Plant Cell

  16. Goal: To get your gene of interest into every cell of a plant If you want to sell your genetically modified seed – EVERY seed needs to have the “new” gene

  17. 3 ways to get your gene into every plant cell • Use Agrobacterium to transform the gametes of a plant, then grow a plant from the seeds after pollination. • Use Agrobacterium to transform plantprotoplasts, then regenerate plants from those cells. • Use gene gun to transform plantcells, then regenerate plants from those cells.

  18. Genetically engineering plants: floral dip Flowers Dip flowers in a solution of Agrobacterium (with your gene plus herbicide- resistance gene)

  19. Agrobacterium can move into pistil and specifically transform the ovules (gametes) Bent lab, U. of Wisconsin

  20. Transforming plants: floral dip Flowers Dip flowers in a solution of Agrobacterium (with your gene plus herbicide- resistance gene) Seeds growing on herbicide: only seeds with herb.-resistance can grow Seed pods Bent lab, U. of Wisconsin

  21. Only Seedlings with T-DNA integrated into their own DNA can survive in presence of herbicide EH, U. of Wisconsin Success Rate = 1/ 3000

  22. Floral dip transformation has only been successful for a few plants (dicots)

  23. 3 ways to get your gene into every plant cell • Use Agrobacterium to transform the gametes of a plant, then grow a plant from the seeds after pollination. • Use Agrobacterium to transform plantprotoplasts, then regenerate plants from those cells. • Use gene gun to transform plantcells, then regenerate plants from those cells.

  24. Piece of Potato Leaves J. Helgeson, UW-Madison

  25. Protoplasts Released from Leaves (cell walls stripped) See 541-542 in Life

  26. Transform protoplasts with Agrobacterium T-DNA (engineered withgene of interest plus herbicide-resistance gene) Agrobacterium cell

  27. Grow protoplasts in a plant medium that contains: • Plant hormones (to stimulate cell division and differentiation) • Herbicide (to prevent non-engineered cells from growing)

  28. Clumps of plant cells grow (called callus). Only cells with herbicide-resistance gene will grow.

  29. New plant will grow from callus

  30. New plant will grow from callus

  31. New plant will grow from callus … and every cell will contain your gene of interest...

  32. …including the gametes which will provide the gene to the next generation.

  33. 3 ways to get your gene into every plant cell • Use Agrobacterium to transform the gametes of a plant • Use Agrobacterium to transform plant protoplasts (stem cells) and regenrate plants from those cells • Use gene gun to transform plant cells and regenerate plants from those cells

  34. Transform plant cells directly with gene gun (especially monocots) Plant cell Gold beads covered with DNA from your gene of interest + herbicide-resistance gene

  35. Gene gun

  36. The gene gun can be used to shoot callus. Then regenerate a plant from transformed callus tissue. (Grow it in a medium with plant hormones & herbicide.)

  37. Steps in Genetic Engineering Step 1: Isolate your gene of interest. Step 2: Clone into a Ti-plasmid:your gene of interest plus an herbicide-resistance gene. Step 3: Transform your plant the altered Ti-plasmid. Step 4: Regenerate entire plant from transformed cells, callus, or seeds.

  38. Subtracting a trait: Flavor Savor Tomato

  39. Softening is due to destruction of pectin Pectin: Cell rigidity PG Polygalacturonase

  40. Softening is due to destruction of pectin Pectin: Cell rigidity PG Polygalacturonase

  41. Antisense Technology: How to prevent PG enzyme from being made SENSE ANTISENSE P TATATACGAAGGCAC…… ATATATGCTTCCGTG…… TACGAAGGCAC..TATA ATGCTTCCGTG…ATAT P AUGCUUCCGUG UACGAAGGCAC… AUGCUUCCGUGUACGAAGGCAC Double stranded RNA cannot be translated because it binds with antisense mRNA.

  42. Antisense Technology Tomato plants carrying the antisense PG gene showed 95% reduction in PG enzyme. These Flavr-Savr tomatoes ripened on the vine but stayed firm for a longer period of time.

  43. Issues in Genetic Engineering What are the impacts of genetic engineering? • Biological or environmental • Socio-economic • Political or legislative

More Related