H1 E.coli /Plasmid Vectors
Section H Host and Vector H1 E.coli /Plasmid Vectors H2 E.coli /Bacterophage Vectors H3 Yeast/YAC and E.coli /BAC H4 Eukaryotic Host/Vectors. H1 E.coli /Plasmid Vectors. E.coli /pBR322 plasmid
H1 E.coli /Plasmid Vectors
E N D
Presentation Transcript
Section H Host and Vector H1 E.coli/Plasmid Vectors H2 E.coli/Bacterophage Vectors H3 Yeast/YAC and E.coli/BAC H4 Eukaryotic Host/Vectors Yang Xu, College of Life Sciences
H1 E.coli/Plasmid Vectors • E.coli/pBR322 plasmid • E.coli/pUC plasmid vectors • Multiple cloning sites • E.coli/pGEM • E.coli/T7 Expression vectors Yang Xu, College of Life Sciences
E A B Ligation products Ligation products: • Recombinant plasmid: With a target fragment. • Recreated vectors: When ligating a target fragment into a plasmid vector, the most frequent unwanted product is the recreated vector plasmid Screening of ligation products: • Agarose gel electrophoresis: For mini-preparations from a number of transformed colonies. Screening by digestion and agarose gel electrophoresis; • Specially developed vectors: For large scale preparations. Now more efficient methods based on specially developed vectors have been devised (see below). Yang Xu, College of Life Sciences
B B ampr tetA pBR322 B X ampr tetA Ori B Ori B B X E.coli/pBR322 plasmid Mechanisms--Insertional inactivation of the resistance genes: If a target DNA fragment is ligated into the coding region of tet A, the gene will become insertionally inactivated. + + Yang Xu, College of Life Sciences
transfer Comparison Ampicillin only Ampicillin and tetracycline Twin antibiotic resistance screening 1. Transformant plating: • Recombinant: can only grow in ampicillin plates; • Recreated vectors: can grow in ampicillin and tetracycline plates 2. Replica plating: The colonies grown on a normal ampicillin plate are transferred, using an absorbent pad, to a second plate containing tetracycline. Recombinant Yang Xu, College of Life Sciences
lac promoter MCS ampr lacZ’ pUC18 Ori ampr/X-gal plate Blue-white screening • Example--pUC18 plasmid: This one contains an ampr and a lac Z gene, which encodes the -galactosidase, and is under the control of the lac promoter. Blue: no insert White: insert • Mechanisms--Insertional inactivation of the lac Z gene: • Under the effect of -galactosidase, the substrate X-gal will produce a blue product. • 1. The blue colonies: probably contain recreated vector. • 2. The white colonies: have no expressed -galactosidase and are hence likely to contain the inserted target fragment. Yang Xu, College of Life Sciences
SmaI AccI HincII XmaI GAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCT LacZ’ Multiple cloning sites • The first vectors which used blue-white selection also pioneered the application of multiple cloning site (MCS). Definition: The pUC series contain an engineered lacZ‘ gene, which has multiple restriction enzyme sites within the first part of the coding region of the gene, which is known as “MCS”. Function: The insertion of target DNA in any of these sites, will inactivates the lac Z’ gene, to give a white colony. EcoRI SacI KpnI BamHI XbaISalI PstI SphI HindIII Yang Xu, College of Life Sciences
RBS MCS TT T7 ATG T7 expressional vector E.coli/T7 expression vectors • Definition of expression vectors: Cloned geneexpression vector hostfusion protein. • Structure • T7 promoter: a strong promoter; • RBS: ribosomebinding site; • ATG: translation initiation condon • MCS: Multiple cloning sites • TT: transcription terminator. • ampr,. ori, • His-tag: Some expression vectors are designed to have six histidine codons that encode a hexahistidine tag at the N terminus of the expressed protein, which allows one-step purification on an affinity column containing Ni2+. Yang Xu, College of Life Sciences
H2 Bacterophage Vectors • Bacteriophage • E.coli/ Replacement vectors • E.coli/Cosmid vectors • E.coli/M13 phage vectors • E.coli/pBluescript vectors • Hybrid plasmid-M13 vectors Yang Xu, College of Life Sciences
Bacteriophage l(life cycle) Process of phage infecting E. coli: In brief, 1. Phage injects its linear DNA into E.coli, then ligates into a circle. 2. The circle DNA may replicate to form many “phage particles”, 3. which are released from the cell by lysis and cell death (lytic phase), or integrate into the host genome (lysogenic phase). Lytic life Lysogenic life UV induce Yang Xu, College of Life Sciences
Coat protein 5’-CGGGGCGGCGACCTCG-3’ 3’-GCCCCGCCGCTGGAGC-5’ Liner DNA Phage Cos end Bacteriophage 5’-CG GGGCGGCGACCTCG-3’ 3’-GCCCCGCCGCTGGA GC-5’ Yang Xu, College of Life Sciences
B B 20kb B Short arm Replace. Long arm 48.5 kb E.coli/ Replacement vectors Examples: EMBL3 and DASH. A representative scheme for cloning: 1. The vector DNA is cleaved with BamH1 and the long (19 kb) and short (9 kb) arms (p116 Fig. 1) are purified; 2. The target fragments are prepared by digestion, also with BamH1 or a compatible enzyme (Sau3A); 3. The target fragments are treated with alkaline phosphatase to prevent them ligating to each other; 4. The arms and the target fragments are ligated together at relatively high concentration to form long linear products. infect E.coli Can not Parking Yang Xu, College of Life Sciences
Replication concata-mers B in vitro Infection of E. coli A mixture of phage coat proteins and the phage DNA-processing enzymes 109 recombinants per mg of vector DNA. phage particles Packaging and infection The Recombinants that can not be packaged: 1. Ligated ends which do not contain an insert; 2. The insert is much smaller or larger than the 20 kb; 3. The recombinants with two left or right arms. Packaging: in vivo cleave individual genomes Packaging Yang Xu, College of Life Sciences
E.coli lawn Plaques Formation of plaques Plaques are the analogs of single bacterial colonies. Formation: The infected E.coli cells from a packaging reaction are spread on an agar plate, The plate has been pre-spread with uninfected cells, which will grow to form a continuous lawn. After incubation, phage-infected cells result in clear areas, that are plaques, where cycles of lysis and re-infection have prevented the cells from growing. • Recombinant DNA may be purified: • from phage particles isolated from plaques or • from the supernatant of a culture infected with a specific recombinant plaque. Yang Xu, College of Life Sciences
cos ampr 5kb B ori B B Infection (32- 47kb) 37-52 kb E.coli/Cosmid vectors • Structure: 1. a plasmid origin of replication (ori); 2. a selectable marker, for example ampr; 3. a cos site, for re-circulating; 4. a suitable restriction site for cloning . Packaging into phage Yang Xu, College of Life Sciences
end RF ini Bacteriophage M13 Infection: M13 particles attach specifically to E.coli sex pili (encoded by a plasmid called F factor), through a minor coat protein (g3p). Binding of g3p induces a structural change in the major capsid protein. This causes the whole particle to shorten, injecting the viral DNA into the host cell. Genome features: Size is small (6.7 kb); Single-stranded; Circular genome; DNA; Positive-sense. g3p g6p g8p Host enzymes g9p g7p Yang Xu, College of Life Sciences
E.coli/M13 phage vectors Structure: The phage particles containa 6.7 kb circular ssDNA. After infection of a sensitive E. coli host, the complementary strand is synthesized, like a plasmid, and the DNA replicated as a dsDNA, the replicative form (RF). Features: The host cells can continue to grow slowly. • ssDNA: The single-stranded forms are continuously packaged and released from the cells as new phage particles. ssDNA has a number of applications, including DNA sequencing and site-directed mutagenesis. • dsDNA: The RF (dsDNA) can be purified in vitro and manipulated exactly like a plasmid. Yang Xu, College of Life Sciences
Cloning in M13 Purpose: When the single-stranded DNA of a fragment is required, a M 13 vector can be used as a common cloning tool. Preparation of ssDNA: 1. Cloning: standard plasmid cloning method can be used to incorporate recombinant DNA into M13 vectors; 2. Transformation: the M13 then infects sensitive E. coli cells; 3. Plating: the host cells grow to form the plaques; 4. Isolation: the ssDNA may then be isolated from phage particles in the growth medium of the plate. Screening: Blue-white screening using MCSs and lacZ' has been engineered into M13 vectors. Examples: The M13mpl8 and M13mp19, which are a pair of vectors in which the MCS are in opposite orientations relative to the M13 origin of replication. Yang Xu, College of Life Sciences
Hybrid plasmid-M13 vectors Definition: A number of small plasmid vectors, for example pBlue-script, have been developed to incorporate M13 functionality. Structure: They contain both plasmid and M13 origins of replication, but do not possess the genes required for the full phage life cycle. Working ways: 1. Plasmid way: they normally propagate as true plasmids, and have the advantages of rapid growth and easy manipulation of plasmid vectors; 2. Phage way: they can be induced to produce single-stranded phage particles by co-infection with a fully functional helper phage, which provides the gene products required for single-strand production and packaging. Yang Xu, College of Life Sciences
H3 YAC and BAC • Cloning large DNA fragments • YAC vectors • BAC vectors Yang Xu, College of Life Sciences
Cloning large DNA fragments • Problems: 1. The analysis of genome organization and the identification of genes, particularly in organisms with large genome sizes (human DNA is 3 109 bp, for example) is difficult to use plasmid and bacteriophage vectors, since the relatively small size capacity of these vectors for cloned DNA means that an enormous number of clones would be required to represent the whole genome in a DNA library. 2. In addition, the very large size of some eukaryotic genes, due to their large intron sequences, means that an entire gene may not fit on a single cloned fragment. • Solution: Vectors with much larger size capacity have been developed to solve these problems. Yang Xu, College of Life Sciences
SnaBI S pYAC3 B B BamHI Yeast/YAC vectors CEN4 is the centromere of chromosome 4 of Yeast. The centromere will segregate the daughter chromosomes. ARS is autonomously replicating sequence, its function is as a yeast origin of replication. TRP1 and URA3 are yeast selectable markers, one for each end, to ensure the right reconstituted YACs survive in the yeast cells. TEL is the telomeric DNA sequence, which is extended by the telomerase enzyme inside the yeast cell. SUP4 is a gene, which is insertionally inactivated, for a red-white color test, like blue-white screening in E. coli. Function: YAC vectors can accept genomic DNA fragments of more than 1 Mb, and hence can be used to clone entire human genes. Yang Xu, College of Life Sciences
E.coli/BAC vectors Yang Xu, College of Life Sciences
H4 Other Eukaryotic Vectors • Cloning in eukaryotes • Transfection of eukaryotic cells • Shuttle vectors • Yeast/episomal plasmids • Agrobacterium tumefaciens/Ti plasmid • Insect cell/Baculovirus • Mammalian cell/viral vectors Yang Xu, College of Life Sciences
Cloning in eukaryotes Reasons: • E. coli as host: Many eukaryotic genes and their control sequences have been isolated and analyzed using gene cloning techniques based on E. coli as host. • Eukaryotic Vectors: However, many applications of genetic engineering (see Section J) require vectors for the expression of foreign genes in different eukaryotic species, for example: 1. Large-scale production of eukaryotic proteins; 2. Engineering of new plants; 3. Gene therapy for human. • Such kinds of vectors designed for a variety of hosts are discussed in this topic. Yang Xu, College of Life Sciences
Transfection of eukaryotic cells Problem: The transfection of DNA into eukaryotic cells is more problematic than E.coli transformation, and efficiency of the process is much lower. Reasons and solutions: • In yeast and plant cells, the cell wall must be digested, which may then take up DNA easily. • Animal cells in culture take up DNA at low efficiency. If it is treated on their surface with calcium phosphate, the efficiency may be increased. Yang Xu, College of Life Sciences
Transfection of eukaryotic cells Other transfection techniques: • Electro-poration: By treatment of the cells with a high voltage, which opens pores in the cell membrane. • Micro-injection: foreign DNA may be microinjected into cells, by using very fine glass pipettes. • Micro-projectiles: DNA may be introduced by micro-projectiles which fire metallic coated with DNA at the target cells. Yang Xu, College of Life Sciences
E.coli Yeast Shuttle vectors Definition: They are the vectors that can shuttle between more than one host, for example, one is E. coli and the other is yeast. Structure and function: Most of the vectors for use in eukaryotic cells are constructed as shuttle vectors. • InE. coli: • This means that they can survive and have the genes (ori and ampr ) required for replication and selection in E. coli. • In the desired eukaryotic cells: • They can also survive in the desired host cells, and let the target insert sequences take effects. Yang Xu, College of Life Sciences
ori ampr YEps 2 origin LEU2 Yeast episomal plasmids Structure of YEps a ori: for replication in E.coli a ampr: for selection in E. coli a 2 origin: for replication in yest LEU2: is homologous gene and a selectable marker in yeast, involved in leucine synthesis. X gene: a shuttle sequence. X gene • Function of YEps • It replicates as plasmids • It integrates into a yeast chromosome by homologous recombination. Yang Xu, College of Life Sciences
Ti Agrobacterium tumefaciens/Ti plasmid-I Definition: Ti plasmid is a kind of plasmid which commonly used to transfer foreign genes into a number of plant species. plant DNA T-DNA expression • Function: The bacterium A. tumefaciens can infects and transfer foreign genes into: • 1. Dicot plants: tomato, tobacco; • 2. Monocot plants, for example rice. Yang Xu, College of Life Sciences
Ti plasmid Modified Ti plasmid transform Infection Plating Regeneration In E.coli Improving: Disarmed T-DNA shuttle vectors • The recombinant T-DNA can be constructed in a E. coli plasmid; • Then transform into the A. tumefaciens cell carrying a modified Ti plasmid without T-DNA. • Infecting plant cell culture with A. Tumefaciens. • Plating transformed clones. • Regenerate plant using hormone In A. tumefaciens • Advantage: • Integrate cloned genes easily, and • The recombinant plants can be reconstituted from the transformed cells. Yang Xu, College of Life Sciences
Insect cell/Baculovirus Definition: Baculovirus is an insect virus which can be used for the overexpression of animal proteins in insect cell culture. Mechanism: • Viral promoter: This viral gene has an extremely active promoter. • Insect cell culture: The same promoter can be used to drive the over-expression of a foreign gene engineered into the baculovirus genome. Function: This method is being used increasingly for large-scale culture of proteins of animal origin, since the insect cells can produce many of the post-translational modifications of animal proteins, which a bacterial expression system cannot. Baculovirus-infected SF21 cells Yang Xu, College of Life Sciences
Mammalian cell/viral vectors • SV40: This virus can infect a number of mammalian species. The SV40 genome is only 5.2 kb in size. • Since it has packaging constraints similar to phage , so it can be not used for transferring large fragments. Yang Xu, College of Life Sciences
Mammalian cell/viral vectors • Retroviruses: They have a ssRNA genome, which is copied into dsDNA after infection. The DNA is then stably integrated into the host genome by a transposition mechanism. They have some strong promoters, and they have been considered as vectors for gene therapy (see Topic J6), since the foreign DNA will be incorporated into the host genome in a stable manner. Yang Xu, College of Life Sciences
That’s all for Section H Yang Xu, College of Life Sciences