erica
Uploaded by
27 SLIDES
509 VUES
270LIKES

DNA

DESCRIPTION

DNA. D N A. DNA is the genetic material found in the nucleus of cells. 1928 Brittish Biologist Frederick Griffith Researches bacteria and mice. Bacteria strain 1 kills mice. Bacteria strain 2 doesn’t kill mice. Bacteria strain 1 heated doesn’t kill mice.

1 / 27

Télécharger la présentation

DNA

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. DNA D N A

  2. DNA is the genetic material found in the nucleus of cells • 1928 • Brittish Biologist Frederick Griffith • Researches bacteria and mice

  3. Bacteria strain 1kills mice

  4. Bacteria strain 2doesn’t kill mice

  5. Bacteria strain 1 heateddoesn’t kill mice

  6. A combination of heated strain 1 & live strain 2kills mice

  7. Conclusions • Something made the harmless bacteria lethal • All descendants of bacteria were lethal • Something must have been transferred from the dead lethal bacteria to the living non-lethal bacteria • WHAT WAS THE TRANSFORMING FACTOR????? HMMMMMMMM????????

  8. 1944 • American Biologist Oswald Avery • Thought maybe proteins were the transforming factor • Treated Griffith’s mixture w/ protein destroying enzymes • Mice still died • Thought maybe DNA was the transforming factor • Treated Griffith’s mixture w/ DNA destroying enzyme • Mice lived Avery concluded DNA was the transforming factor.

  9. Many people were still skeptical • 1952 • Alfred Hershey & Martha Chase • Did tests using viruses • VIRUS a nucleic acid surrounded by a protein coat • Not living • Not made of cells • Can only reproduce by infecting living cells

  10. Bacteriophage: a virus that only infects bacteria • Hershey & Chase knew DNA or proteins were the hereditary material • Which one?? • HMMMMM???

  11. Chase & Hershey Conclusions • DNA was what caused the bacteria to make new phages • Not proteins DNA is the hereditary material

  12. DNA • The heritable genetic information of an organism • Deoxyribonucleic acid • A kind of nucleic acid • A polymer • Made of nucleotides (monomers)

  13. DNA vs. RNA • RNA has an extra Oxygen

  14. Quick MACROmolecule review • Which subunits make up the following: -Carbohydrate -Protein -Lipid -Nucleic acid *Can you give and example or function of each?

  15. Nucleotides • The building blocks (monomers) of nucleic acids • So what are nucleic acids? • Polymers made of nucleotides • 4 types of nucleotides make up DNA

  16. Each nucleotide is made up of: • Sugar • Phosphate • Nitrogenous Base

  17. Nitrogenous Bases • The four nucleotides that make up DNA differ only by their bases. • Two major types: • Pyrimidines – single rings • Cytosine • Thymine • Purines – double rings • Adenine • Guanine

  18. Bases

  19. How to keep them straight?? • Look like dog dishes • Dogs eat Purina dog food • Purines  Purina • Dogfood can be bought in bulk @ Agway • Adenine Guanine  AGWAY

  20. Structure and Function • Think of other examples where structure and function are related. • -Biochemistry • -Cells

  21. How to keep them straight?? • Single ring looks like a pie • CUT me a piece of pie • Cytosine Uracil Thymine • Uracil is only found in RNA • Pie Pyrimidine

  22. DNA Strands • Nucleotides are joined together by covalent bonds • Connect sugar—phosphate—sugar—phosphate • Sugar-phosphate backbone

  23. Bonding… • What subatomic particles are involved in bonding? • Identify three types of bonding. • How are they similar? Different? • Which is the strongest type? Weakest? • Can you draw a sketch demonstrating the two types of bonding involved in the polarity and surface tension of water?

  24. DNA Structure • Double Helix • Two strands w/ complementary base pairs • Watson & Crick

  25. Complementary Base Pairs • Adenine always pairs with Thymine • 2 H-bonds • Guanine always pairs with Cytosine • 3 H-bonds So which is easier to break? A=T G=C

  26. Practice • AAGCTACGGTTCACATGATCAACTTGA • TTCGATGCCAAGTGTACTAGTTGAACT • GATACA • CTATGT • AGCATTAGGAATTACAG • TCGTAATCCTTAATGTC

More Related