DNA
DNA. D N A. DNA is the genetic material found in the nucleus of cells. 1928 Brittish Biologist Frederick Griffith Researches bacteria and mice. Bacteria strain 1 kills mice. Bacteria strain 2 doesn’t kill mice. Bacteria strain 1 heated doesn’t kill mice.
DNA
E N D
Presentation Transcript
DNA D N A
DNA is the genetic material found in the nucleus of cells • 1928 • Brittish Biologist Frederick Griffith • Researches bacteria and mice
Conclusions • Something made the harmless bacteria lethal • All descendants of bacteria were lethal • Something must have been transferred from the dead lethal bacteria to the living non-lethal bacteria • WHAT WAS THE TRANSFORMING FACTOR????? HMMMMMMMM????????
1944 • American Biologist Oswald Avery • Thought maybe proteins were the transforming factor • Treated Griffith’s mixture w/ protein destroying enzymes • Mice still died • Thought maybe DNA was the transforming factor • Treated Griffith’s mixture w/ DNA destroying enzyme • Mice lived Avery concluded DNA was the transforming factor.
Many people were still skeptical • 1952 • Alfred Hershey & Martha Chase • Did tests using viruses • VIRUS a nucleic acid surrounded by a protein coat • Not living • Not made of cells • Can only reproduce by infecting living cells
Bacteriophage: a virus that only infects bacteria • Hershey & Chase knew DNA or proteins were the hereditary material • Which one?? • HMMMMM???
Chase & Hershey Conclusions • DNA was what caused the bacteria to make new phages • Not proteins DNA is the hereditary material
DNA • The heritable genetic information of an organism • Deoxyribonucleic acid • A kind of nucleic acid • A polymer • Made of nucleotides (monomers)
DNA vs. RNA • RNA has an extra Oxygen
Quick MACROmolecule review • Which subunits make up the following: -Carbohydrate -Protein -Lipid -Nucleic acid *Can you give and example or function of each?
Nucleotides • The building blocks (monomers) of nucleic acids • So what are nucleic acids? • Polymers made of nucleotides • 4 types of nucleotides make up DNA
Each nucleotide is made up of: • Sugar • Phosphate • Nitrogenous Base
Nitrogenous Bases • The four nucleotides that make up DNA differ only by their bases. • Two major types: • Pyrimidines – single rings • Cytosine • Thymine • Purines – double rings • Adenine • Guanine
How to keep them straight?? • Look like dog dishes • Dogs eat Purina dog food • Purines Purina • Dogfood can be bought in bulk @ Agway • Adenine Guanine AGWAY
Structure and Function • Think of other examples where structure and function are related. • -Biochemistry • -Cells
How to keep them straight?? • Single ring looks like a pie • CUT me a piece of pie • Cytosine Uracil Thymine • Uracil is only found in RNA • Pie Pyrimidine
DNA Strands • Nucleotides are joined together by covalent bonds • Connect sugar—phosphate—sugar—phosphate • Sugar-phosphate backbone
Bonding… • What subatomic particles are involved in bonding? • Identify three types of bonding. • How are they similar? Different? • Which is the strongest type? Weakest? • Can you draw a sketch demonstrating the two types of bonding involved in the polarity and surface tension of water?
DNA Structure • Double Helix • Two strands w/ complementary base pairs • Watson & Crick
Complementary Base Pairs • Adenine always pairs with Thymine • 2 H-bonds • Guanine always pairs with Cytosine • 3 H-bonds So which is easier to break? A=T G=C
Practice • AAGCTACGGTTCACATGATCAACTTGA • TTCGATGCCAAGTGTACTAGTTGAACT • GATACA • CTATGT • AGCATTAGGAATTACAG • TCGTAATCCTTAATGTC