130 likes | 312 Vues
Folding of riboswitches during RNA transcription. with Ben Sauerwine (Carnegie Mellon, Physics). Background information What are riboswitches? Folding of riboswitch terminators Efficient folding of hairpins Evolution of terminator sequences. Transcription start. Transcription stop.
E N D
Folding of riboswitches during RNA transcription with Ben Sauerwine (Carnegie Mellon, Physics) • Background information • What are riboswitches? • Folding of riboswitch terminators • Efficient folding of hairpins • Evolution of terminator sequences
Transcription start Transcription stop ... ... Transcription Translation “Central Dogma” of Molecular Biology DNA Coding Region 5’ untranslated untranslated 3’ RNA Protein (RNA World hypothesis)
messenger RNA structure Primary structure (sequence): UUACAAUAUAAUAGGAACACUCAUAUAAUCGCGUGGAUAUGGCACGCAAGUUUCUACCGGGCACCGUAAAUGUCCGACUAUGGGUGAGCAAUGGAACCGCACGUGUACGGUUUUUUGUGAUAUCAGCAUUGCUUGCUCUUUAUUUGAGCGGGCAAUGCUUUUUUUAUUCUCAUAACGGAGGUAGACAGGAUGGAAGCACUGAAACGGAAAAUAGAGGAAGAAGGCGUCGUAUUAUCUGAUCAGGUAUUGAAAGUGGAUUCUUUUUUGAAUCACCAAAUUGAUCCGCUGCUUAUGCAGAGAAUUGGUGAUGAAUUUGCGUCUAGGUUUGCAAAAGACGGUAUUACCAAAAUUGUGACAAUCGAAUCAUCAGGUAUCGCUCCCGCUGUAAUGACGGGCUUGAAGCUGGGUGUGCCAGUUGUCUUCGCGAGAAAGCAUAAAUCGUUAACACUCACCGACAACUUGCUGACAGCGUCUGUUUAUUCCUUUACGAAGCAAACAGAAAGCCAAAUCGCAGUGUCUGGGACCCACCUGUCGGAUCAGGAUCAUGUGCUGAUUAUCGAUGAUUUUUUGGCAAAUGGACAGGCAGCGCACGGGCUUGUGUCGAUUGUGAAGCAAGCGGGAGCUUCUAUUGCGGGAAUCGGCAUUGUUAUUGAAAAGUCAUUUCAGCCGGGAAGAGAUGAACUUGUAAAACUGGGCUACCGAGUGGAAUCUUUGGCAAGAAUUCAGUCUUUAGAAGAAGGAAAAGUGUCCUUCGUACAGGAGGUUCAUUCAUGA (Bacillus Subtilis XPT gene) • Folded secondary structure • Complementary base pairing • Can this really matter ?!?
Representations of Secondary Structure AU CG (GU) Tertiary Structure ....((((((((.....(((((.......)))))..........((((((.......))))))..))))))))....
Riboswitch folding during transcription Anti- terminator Terminator stem G Aptamer stem G Guanine absent Antiterminator forms Transcription proceeds, Gaunine synthesized “XPT switched on” “Gene Regulation by Riboswitches” Mandal & Breaker Nature Reviews (2004) Guanine in solution, stabilizes aptamer Terminator forms, stalling polymerase Transcription halts, Guanine not synthesized “XPT switched off”
Work in progress • Antiterminator lifetime • First passage time for escape from metastable state • (Ben Sauerwine, short talk) 2. Natural selection of terminator sequences Evidence that terminators are selected for reliable folding (This talk)
Sequence length 43 nt Transcription rate 50 nt/second
Real Sequence Typical Shuffled Sequence Atypical Shuffled Sequence
Atypical shuffled sequence Alternate folds Metastable G=-3.4 kCal/mol Stable G=-25.0 kCal/mol Metastable G=-7.9 kCal/mol
Conclusions RNA secondary structure does matter (sometimes) Operation of riboswitch successfully modeled with Kinfold Evidence for natural selection of efficiently folding sequences