1 / 45

BIOLOGY A

BIOLOGY A. Standard 4A Week 2 Ms.Darlak. Warm-up 12/03. Why is DNA replication important? What could happen if there were mistakes?. So, why is this important?

eugene
Télécharger la présentation

BIOLOGY A

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. BIOLOGY A Standard 4A Week 2 Ms.Darlak

  2. Warm-up 12/03 • Why is DNA replication important? • What could happen if there were mistakes?

  3. So, why is this important? Through DNA replication, the genetic make-up of a cell is copied and passed on to new cells during mitosis or to new generations through meiosis followed by sexual reproduction. If there are mistakes or mutations, new characteristics (good and bad) could be created.

  4. Agenda 12/03 • Why is making protein important? p.8 • What is RNA? p.10

  5. Why is making protein in a cell important? P.8 • Proteins Functions • Building Material – • Make up most of material in cells cytoplasm and cytoskeleton (spindle fibers and centriole). • Make spindle fibers in mitosis • Make muscle, hair, nails, cartilage • Enzymes- (enzymes are proteins) • control chemical reactions: like breaking down glucose molecules to get energy • digest food

  6. Why is making protein in a cell important? • Gene Expression – • proteins code for specific genes that produce characters and traits. Sequence of A-T-G-C contains information for making genes. So, if DNA holds the instructions for making proteins, DNA controls the cell!

  7. RNA p.10 • What is it? • Ribonucleic Acid • NUCLEOTIDE with ribose sugar • Single-stranded • Uracil instead of Thymine

  8. 2) What are the differences between RNA and DNA? RIBOSE DEOXYRIBOSE SINGLE STRNADED DOUBLE STRANDED URACIL A, C, G THYMINE A, C, G

  9. DNA vs RNA DNA Deoxyribose sugar RNA Ribose sugar

  10. 4) Three types of RNA Transcription mRNA: Messenger RNA: reads DNA sequence and carries instructions for protein from nucleus to cytoplasm (ribosomes). CODONS – 3 nucleotides rRNA: Ribosomal RNA: ribosome molecule clamps onto the mRNA and reads the information of the nitrogen base sequence (A-U-G-C) tRNA :Transfer RNA: carries amino acids to ribosome and reads the mRNA sequence (CODON) and matches with the complimentary ANTICODON base triplet, until a protein is assembled. Translation

  11. Warm-up 12/04 • What are Three differences between RNA and DNA? • RNA isSINGLE-STRANDED, DNA is DOUBLE • sugar inRNA is RIBOSE, in DNA it’s DEOXYRIBOSE • RNA substitutes URACIL to pair with adenine (A-U) in DNA THYMINE pairs this adenine (A-T)

  12. Agenda 12/03 • Transcription Notes p. 10 • Video • Animations • QUIZ 4-1 Tomorrow!

  13. From DNA to gene expression How does DNA makes a physical trait? Transcription Translation Protein Let’s start with transcription…..

  14. nucleus cytoplasm

  15. 3) Role of RNA p. 10 Role of RNA: Let’s use the an analogy of a car assembly line (car = protein) • DNA: Engineer creates the car blueprints • mRNA:Workers make the car part • tRNA: Suppliersbring the parts (amino acids)to the assembly line • rRNA: Assembly plant where cars are made • Amino acid by amino acid, they assemble the protein (cars)

  16. DNA Transcription p.11 RNA polymerase binds to DNA, and unwinds two DNA strands. It then reads ONE side of the DNA strand and transcribes the “message” on to mRNA following base-pairing rules. (Uracil replaces Thymine) This is the “message” or instructions for making a gene. Takes place in the nucleus.

  17. DNA Transcription – DNA to RNA p.11 Then mRNA travels out of the nucleus to the cytoplasm then to the ribosome.Message is written in CODONS (3 nucleotides = 1 amino acid). How is DNA transcription different from replication?

  18. Transcription: How mRNA is made

  19. Transcription Quiz If the sequence of bases on one DNA strand is: CCG GAT TTA CAT What will the sequence be on the mRNA strand? GGC CUA AAU GUA

  20. What are the differences between RNA and DNA? RNA DNA • SINGLE-STRANDED • Sugar =RIBOSE • URACIL instead of Thymine • DOUBLE STRANDED • Sugar = DEOXYRIBOSE • THYMINE instead of Uracil

  21. Warm-up 12/05 Transcribe the following DNA sequence into mRNA. • DNA: TAC ACA CCC GGG GAC TTC ACT • mRNA : AUG UGU GGG CCC CUG AAG UGA

  22. Agenda 12/05 • Review Transcription • 4A QUIZ 1

  23. The “Central Dogma” • Flow of genetic information in a cell • How do we move information from DNA to proteins? transcription translation RNA DNA protein trait DNA gets all the glory, but proteins do all the work! replication

  24. RNA polymerase Transcription Matching bases of DNA & RNA A C U • Match RNA bases to DNA bases on one of the DNA • RNA chain grows in the __________direction • added to the ________ G A G G U C U U G C 5' → 3' A C A 3' END U A G A C U A 5' 3' G C C A T G G T A C A G C T A G T C A T C G T A C C G T

  25. uuu RNA polymerase Transcription • proceeds until TERMINATOR site on the RNA • RNA molecule is then released to head to ribosome G U 5' 3' A C C A A A U A G A G C G U G C U U T G G T A C A G C T A G T C A T C G T A C C G T

  26. Transcription Videos • Step by Step • http://youtu.be/ztPkv7wc3yU • Real TIme • http://youtu.be/41_Ne5mS2ls

  27. Transcription Animations • http://www.johnkyrk.com/DNAtranscription.html • http://www-class.unl.edu/biochem/gp2/m_biology/animation/gene/gene_a2.html • http://learn.genetics.utah.edu/units/basics/transcribe/

  28. 25. Answer REPLICATION 9 pts • Top Strand • GGG ATT CGC ATC 4 pts • Bottom Strand • CCC TAA GCG TAG 4 pts • Anti-Parallel Arrows 1 pt

  29. 26. Answer TRANSCRIPTION 6 pts • TAC GAG TAA GAC CTA ATT • AUG CUC AUU CUG GAU UAA • Put # correct/15 on lower rt corner

  30. Warm-up 12/06 REPLICATION DNA → DNA = ____________ DNA → RNA = _______________ RNA→ Protein = _____________ Keep your warm-up for now. TRANSCRIPTION TRANSLATION

  31. Transcription fromDNA nucleic acid languagetoRNA nucleic acid language Transcription = DNA → RNA (Occurs in NUCLEUS)

  32. Translation fromRNA nucleic acid languagetoamino acid language Translation = RNA → PROTEINS (Occurs on RIBOSOMES in CYTOPLASM)

  33. Agenda 12/06 • Quiz 4A 1 Back to Correct • Translation Notes • Translation Animations • Homework pps. 17-18

  34. aa aa aa aa aa ribosome aa aa aa aa aa aa From gene to protein nucleus cytoplasm transcription translation DNA mRNA protein trait

  35. From DNA to gene expression How does DNA makes a physical trait? Transcription Translation Protein Let’s move on to translation…..

  36. What is Translation? • RNA Protein • mRNA meets tRNA at ribosome • tRNA brings amino acid • Codons (mRNA) match anticodons (tRNA) • Amino acid chain forms protein (Polypeptide)

  37. Translation p.12 • The ribosome, mRNA and tRNA which is carrying the amino acid methionine bind together. • New tRNA arrives and binds to the next codon on the mRNA. A peptide bond forms between the 1st amino acid and the new amino acid brought by the tRNA.

  38. Translation p.12 • First tRNA detaches and leaves its amino acid. With each new tRNA, the amino acid chain grows. • The process ends when the stop codon is reached. • The amino acid chain is released, and the ribosome complex falls apart.

  39. TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA MetArgValAsnAlaCysAla protein ? How does mRNA code for proteins? How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)? 4 ATCG 4 AUCG 20

  40. TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA codon Met ArgVal AsnAlaCysAla protein ? mRNA codes for proteins in triplets

  41. UAC GCA CAU Met Arg Val How are the codons matched to amino acids? DNA TACGCACATTTACGTACGCGG mRNA AUGCGUGUAAAUGCAUGCGCC codon tRNA anti-codon amioacid

  42. Universal Genetic Code Second position mRNA 5' U     C     A     G     3'     U Phe PheLeuLeu SerSerSerSer TyrTyrTyrTyr CysCysStopTrp UCAG C LeuLeuLeuLeu ProProProPro HisHisGlnGln ArgArgArgArg UCAG A IleIleIleMet ThrThrThrThr AsnAsnLysLys SerSerArgArg UCAG G ValValValVal AlaAlaAlaAla AspAspGluGlu GlyGlyGlyGly UCAG First position Third position

  43. Codon Table

  44. Here is a piece of mRNA. Every 3 letters = a codon. Each codon codes for an amino acid. Translate the following strand: AUG GCU GUU GAG CAC CGU UGA Start- alanine - valine - glutamate - histidine - arginine - stop Try another: AUG UGU GGG CCC CUG AAG UGA Start cysteineglycineprolineleucine lysine stop

  45. Homework • Complete pps. 17-18

More Related