140 likes | 278 Vues
Replication and Central Dogma January 2009. DNA structure and properties. During an ocean exploration you discover ancient colelancanth DNA. You denature your DNA and discover that a single strand is composed of: 10% A, 10% T, 45% C and 45%G Which of the following could you conclude:
E N D
Replication and Central Dogma January 2009
During an ocean exploration you discover ancient colelancanth DNA. You denature your DNA and discover that a single strand is composed of: 10% A, 10% T, 45% C and 45%G Which of the following could you conclude: A. Base-pairing in colelanth DNA follows the same rules as human DNA. B. Base-pairing in colelanth DNA follows different rules than human DNA. C. You need more information http://www.pbs.org/wgbh/nova/fish/
If a single stranded DNA molecule is composed of 40% thymine, what percentage of guanine would be expected? A. 10% B. 20% C. 30% D. 40% E. Need more information
Now let’s look at transcription DNA to RNA in more detail… Where does transcription start? Promoter AUG start codon The promoter and the AUG start codon are the same thing
5’ AGCTACAGGGTG 3’ 3’ TCGATGTCCCAC 5’ Amy Roloff from “Little People, Big World” has a mutation in her FGFR3 gene. Part of the DNA sequence from Amy’s FGFR3 gene is: Coding strand http://tlc.discovery.com/fansites/lpbw/bios/amy.html Template strand What is the sequence of Amy’s FGFR3 mRNA? A. 3’AGCUACAGGGUG 5’ B. 5’AGCUACAGGGUG 3’ C. 3’UCGAUGUCCCAC 5’ D. 5’UCGAUGUCCCAC 3’
Matt Roloff from the TV show “Little People, Big World” has a mutation in his SLC26A gene. Part of the DNA sequence from Matt’s SLC25A gene is: Coding strand 5’--Promoter-- CGCTACAGAGTG 3’ 3’------------ GCGATGTCTCAC 5’ Template strand What is the sequence of Matt’s mRNA? A. 3’CGCUACAGAGUG 5’ B. 5’CGCUACAGAGUG 3’ C. 3’GCGAUGUCUCAC 5’ D. 5’GCGAUGUCUCAC 3’
5’ CG TATA GGCTGATGTGGCAC 3’ 3’ GCATATCCGACTACACCGTG 5’ • Which of the following would be the correct product of transcription from this DNA sequence? The arrow shows the transcription start site. • A. 5’ GTGCCACATCA 3’ • B. 5’ GUGCCACAUCA 3’ • C. 5’ TGATGTGGCAC 3’ • D. 5’ UGAUGUGGCAC 3’ • E. 5’ ACUACACCGUG 3’
What is the amino acid sequence of Amy’s FGFR3 protein? http://tlc.discovery.com/fansites/lpbw/bios/amy.html mRNA 5’AGC UACAGG GUG 3’ A. Ser-Tyr-Gly-Val B. Ser-Tyr-Arg-Val C. Arg-Tyr-Lys-Val D. Gly-Tyr-Val-Val
If you use a computer program that allows you to take a known DNA sequence and ‘translate’ it into an amino acid sequence of a protein, how many possible amino acid sequence(s) could you get from a single DNA sequence? A. 1 B. 3 C. 6 D. many
How are proteins are made? • Transcription of the DNA to a protein • Translation of the pre-mRNA to a protein • Transcription of the mRNA to a protein • Translation of the mRNA to a protein • Translation of a string of amino acids
What best describes the genetic code? A. The way ribosomes recognize genes in mRNA B. The order of nucleotides in a gene from which a protein is made. C. A unique set of 24 nucleotide triplets needed to translate mRNAs. D. The set of all possible 64 nucleotide triplets from 4 bases (43 = 64)