finola
Uploaded by
22 SLIDES
448 VUES
220LIKES

RNA 的生物合成

DESCRIPTION

RNA 的生物合成. Biosynthesis of RNA. 1.Concept of RNA biosynthesis. Transcription is the synthesis of a single- stranded RNA from DNA template. Transcription is asymmetry.  RNA synthesis occurs in the 5’  3’ direction. The transmission of the genetic infor-mations is from DNA to RNA.

1 / 22

Télécharger la présentation

RNA 的生物合成

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. RNA 的生物合成 Biosynthesis ofRNA

  2. 1.Concept of RNA biosynthesis • Transcription is the synthesis of a single- stranded RNA from DNA template. Transcription is asymmetry.  • RNA synthesis occurs in the 5’3’ direction. • The transmission of the genetic infor-mations is from DNA to RNA.

  3. 2.template in RNA biosynthesis

  4. coding strand* positive strand Crick strand antisense strand 3’ 5’ GTAC CATG 3’ 5’ GUAC 3’ sense strand 5’ Watson strand new RNA strand negative strand template strand*

  5. transcriptional template template 5’ 3’ 3’ 5’ 3’ 5’ 5’ 3’ 5’ 3’ 5’ 3’ It is the fragments of gDNA. It is only one of double-strand DNA, therefore, transcription is asymmetric.

  6. RNA polymerase in E.coli  molecular weight:480kd  consists of 2’ 3. Enzymes in RNA biosynthesis  The 2’ complex is core enzyme in RNA polymerase  The 2’ complex isholoenzyme of RNA polymerase

  7. determines which genes are transcribed catalytic site ’ binds DNA template  recognizes transcription initiation site The function of subunits of RNA polymerase in E. coli

  8. RNA polymeras in eukaryote variety transcripts respond to amanitin Ⅰ 45s-rRNAresistant (28S, 18S, 5.8S) Ⅱ* hnRNA(mRNA)very sensitive Ⅲ 5s-rRNA midding tRNA,snRNA sensitive

  9. 3’ • There is some sequence, which is recognized and bound by RNA polymerase, on 5’ end of transcriptional genes. • characters of the sequence • There are many A-T pairs • There are some consensus • sequence gene   +  ’ 5’ 4. Promotor

  10. The binding region 5’ gene termination signal 5’ -50 -40 -30 -20 -10 1 10 transcribed initiation site promoter site

  11. In prokaryotes promoter 40-80bp 5’ 2 3 1 -50 -40 -30 -20 -10 1 10 gene transcribed initiation site TATAATPu ATATTAPy TTGACA AACTGT Binding site Pribnow box Recognition site

  12. In eukaryotes promoter 5’ -50 -40 -30 -20 -10 1 10 gene GC box CAAT box TATA box Hogness box

  13. 5. terminator DNA 5’…GCCGCCAGTTCGGCTGGCGGCATTTT… 3’ RNA 5’…GCCGCCAGUUCGGCUGGCGGCAUUUU…3’ C • The signals that terminates transcri-ption are localized in the gene 3’ end. • A simple termination signal is a GC- rich region that is a palindrome, followed by AT-rich sequence. • The RNA made from the DNA palindrome is self-complementary and so formed a internal hairpin structure followed by a few U bases. G U U G G AC C G C C G C UG G C G G C 5’ A U U U U-OH 3’

  14. 6. Process of RNA biosynthesis (1) initiation (2) elongation 1. initiation (3) termination 2. elongation

  15. (1) initiation

  16. (2) elongation

  17. (3) termination Dependent upon  factor RNA polymerase Promoter Terminator Gene 5’ 5’ c c c c c c c c c c   new RNA

  18.  factor function:  It can bind with polyC in RNA 3’end.  It has activity of ATPase and helicase.  It may denature short RNA-DNA hybrid double strands.

  19. Independent to  factor: The base sequence and transcript RNA secondary structure of rplL gene 3’ end in E. coli. TTGCAGCCTGAGAAATCAGGCTGATGGCTGGTGACTTTTTAGTCACCAGCCTTTTT or UUUUU UUUUU

  20. transcription termination for independent to  factor RNA polymerase coding strand 5’ 5’ 5’ template strand new RNA transcript

  21. modification and termination of transcription about eukaryotegene RNA polymerase coding strand 5’ AATAAA GTGTGT modification point TTATTT CACACA 5’ 5’ GUGUGU AAUAAA template strand new RNA strand AAA AAA polyA tail 5’ AAA AAA

  22. Polyribosomes (or polysomes) • High speed • High efficiency

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer