franz
Uploaded by
71 SLIDES
874 VUES
720LIKES

Chapter 20

DESCRIPTION

Chapter 20. DNA Technology & Genomics. Overview: Understanding & Manipulating Genomes One of the greatest achievements of modern science Has been the sequencing of the human genome, which was largely completed by 2003 DNA sequencing accomplishments

1 / 71

Télécharger la présentation

Chapter 20

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Chapter 20 DNA Technology & Genomics

  2. Overview: Understanding & Manipulating Genomes • One of the greatest achievements of modern science • Has been the sequencing of the human genome, which was largely completed by 2003 • DNA sequencing accomplishments • Have all depended on advances in DNA technology, starting with the invention of methods for making recombinant DNA

  3. DNA technology has launched a revolution in the area of biotechnology • Biotechnology- manipulation of organisms or their genetic components to make useful products • Ex: Of DNA technology is the microarray • A measurement of gene expression of 1000’s of diff genes

  4. Figure 20.1

  5. 20.1: DNA cloning-- production of multiple copies of a specific gene or other DNA segment • To work directly w/ specific genes • gene cloning-- method for preparing well-defined, gene-sized pieces of DNA in multiple identical copies,

  6. DNA Cloning and Its Applications: A Preview • Most methods for cloning pieces of DNA in the lab • Share certain general features, such as the use of bacteria & their plasmids

  7. Cell containing geneof interest Bacterium Gene inserted into plasmid 1 Gene of interest Plasmid Bacterialchromosome DNA ofchromosome RecombinantDNA (plasmid) 2 Plasmid put into bacterial cell Recombinatebacterium Host cell grown in culture,to form a clone of cellscontaining the “cloned”gene of interest 3 3 Gene of interest Protein expressedby gene of interest Copies of gene Protein harvested 4 Basic research and various applications Basic research on protein Basic research on gene Gene used to alterbacteria for cleaningup toxic waste Human growth hormone treatsstunted growth Gene for pestresistance inserted into plants Protein dissolvesblood clots in heartattack therapy Figure 20.2 • Overview of gene cloning with a bacterial plasmid, showing various uses of cloned genes

  8. DNA cloning– uses plasmids from bacteria • Recombinant DNA is made by putting foreign DNA into plasmids • Plasmids are then put back into bacteria cells • They replicate in a culture as the recombinant bacteria reproduce & make clones of identical cells • makes many copies of the gene or can make protein coded for from foreign DNA

  9. Using Restriction Enzymes to Make Recombinant DNA • Bacterial restriction enzymes can be used to make recombinant DNA • Cut DNA molecules at a limited # of specific DNA seq’s, called restriction sites • These protect bacteria from phages by cutting up foreign DNA • The cell protects its own DNA by methylation in its own restriction sites

  10. restriction enzymes can make many cuts in a DNA molecule • gives set of restriction fragments • most useful restriction enzymes cut DNA in a staggered way • making fragments w/ “sticky ends” that can bond w/ complementary “sticky ends” of other fragments • DNA ligase seals the bonds b/w restriction fragments

  11. 1 3 2 Restriction site 5 3 DNA G A A T T C 3 5 C T T A A G Restriction enzyme cutsthe sugar-phosphatebackbones at each arrow A A T T C G C T T A A G Sticky end A A T T C G G DNA fragment from another source is added. Base pairing of sticky ends produces various combinations. C T T A A Fragment from differentDNA molecule cut by thesame restriction enzyme G A A T T C A A T T C G C T T A A G G T T A A C One possible combination DNA ligaseseals the strands. Figure 20.3 Recombinant DNA molecule • Using a restriction enzyme and DNA ligase to make recombinant DNA

  12. Cloning a Eukraryotic Gene in a Bacterial Plasmid • cloning vector-- the original plasmid • DNA molecule that can carry foreign DNA into a cell & replicate there

  13. Cloning is used to prepare many copies of a gene of interest for use in sequencing the gene, in producing its encoded protein, in gene therapy, or in basic research. 1 2 3 In this example, a human gene is inserted into a plasmid from E. coli. The plasmid contains the ampR gene, which makes E. coli cells resistant to the antibiotic ampicillin. It also contains the lacZ gene, which encodes -galactosidase. This enzyme hydrolyzes a molecular mimic of lactose (X-gal) to form a blue product. Only three plasmids and three human DNA fragments are shown, but millions of copies of the plasmid and a mixture of millions of different human DNA fragments would be present in the samples. APPLICATION TECHNIQUE lacZ gene (lactose breakdown) Bacterial cell Isolate plasmid DNA and human DNA. Human cell Restriction site Cut both DNA samples with the same restriction enzyme ampR gene (ampicillin resistance) Gene of interest Bacterial plasmid Stickyends Human DNAfragments Mix the DNAs; they join by base pairing. The products are recombinant plasmids and many nonrecombinant plasmids. Figure 20.4 Recombinant DNA plasmids Producing Clones of Cells

  14. 4 5 RESULTS Introduce the DNA into bacterial cells that have a mutation in their own lacZ gene. Recombinantbacteria Colony carrying non-recombinant plasmid with intact lacZ gene Colony carryingrecombinant plasmidwith disrupted lacZ gene Plate the bacteria on agar containing ampicillin and X-gal. Incubate until colonies grow. Only a cell that took up a plasmid, which has the ampR gene, will reproduce and form a colony. Colonies with nonrecombinant plasmids will be blue, because they can hydrolyze X-gal. Colonies with recombinant plasmids, in which lacZ is disrupted, will be white, because they cannot hydrolyze X-gal. By screening the white colonies with a nucleic acid probe (see Figure 20.5), researchers can identify clones of bacterial cells carrying the gene of interest. Bacterialclone

  15. Identifying Clones Carrying a Gene of Interest • clone w/ gene of interest • Can be identified by nucleic acid hybridization: • radioactively labeled nucleic acid probe that has a seq complementary to the gene, a process called nucleic acid hybridization

  16. 4 3 2 Hybridization with a complementary nucleic acid probe detects a specific DNA within a mixture of DNA molecules. In this example, a collection of bacterial clones (colonies) are screened to identify those carrying a plasmid with a gene of interest. APPLICATION RESULTS TECHNIQUE Cells from each colony known to contain recombinant plasmids (white colonies in Figure 20.4, stap 5) are transferred to separate locations on a new agar plate and allowed to grow into visible colonies. This collection of bacterial colonies is the master plate. Colonies containinggene of interest Master plate Master plate ProbeDNA Solutioncontainingprobe Radioactivesingle-strandedDNA Gene ofinterest Film Single-strandedDNA from cell Filter Filter lifted andflipped over Hybridizationon filter The filter is treated to break open the cells and denature their DNA; the resulting single-stranded DNA molecules are treated so that they stick to the filter. A special filter paper ispressed against themaster plate,transferring cells to the bottom side of thefilter. After the developed film is flipped over, the reference marks on the film and master plate are aligned to locate colonies carrying the gene of interest. The filter is laid underphotographic film,allowing anyradioactive areas toexpose the film(autoradiography). 1 Colonies of cells containing the gene of interest have been identified by nucleic acid hybridization. Cells from colonies tagged with the probe can be grown in large tanks of liquid growth medium. Large amounts of the DNA containing the gene of interest can be isolated from these cultures. By using probes with different nucleotide sequences, the collection of bacterial clones can be screened for different genes. Figure 20.5 • Nucleic acid probe hybridization

  17. Foreign genome cut up with restriction enzyme or Recombinantplasmids Bacterialclones Recombinantphage DNA Phageclones (a) Plasmid library (b) Phage library Figure 20.6 Storing Cloned Genes in DNA Libraries genomic library made using bacteria • collection of recombinant vector clones made by cloning DNA fragments derived from an entire genome

  18. A genomic library made using bacteriophages • Is stored as a collection of phage clones

  19. complementary DNA (cDNA) library • made by cloning DNA made in vitro by reverse txn of all mRNA made by a particular cell

  20. Diff b/w genomic & cDNA library: • Genomic is the total genome • cDNA is only the expressed genes

  21. Cloning and Expressing Eukaryotic Genes • As an alternative to screening a DNA library for a particular nucleotide sequence • The clones can sometimes be screened for a desired gene based on detection of its encoded protein

  22. Bacterial Expression Systems • Several technical difficulties • Hinder the expression of cloned euk genes in bacterial host cells • To overcome difficulties in promoters & other DNA control seq’s • Scientists use an expression vector, a cloning vector that has a highly active prok promoter

  23. Eukaryotic Cloning and Expression Systems • Using cultured euk cells as host cells & yeast artificial chromosomes (YACs) as vectors • Helps avoid gene expression problems • b/c yeast has plasmids, & are euk’s • Prok’s don’t have RNA splicing machinery, & post trslnl modification abilities

  24. Amplifying DNA in Vitro: The Polymerase Chain Reaction (PCR) • Making many copies of a gene: • polymerase chain reaction (PCR) • Can make many copies of a specific target segment of DNA • Uses primers that bracket the desired seq • Uses a heat-resistant DNA pol

  25. 3 1 2 3 5 Target sequence APPLICATION With PCR, any specific segment—the target sequence—within a DNA sample can be copied many times (amplified) completely in vitro. 3 5 Genomic DNA 3 5 Denaturation: Heat briefly to separate DNA strands 5 3 TECHNIQUE Annealing: Cool to allow primers to hydrogen-bond. The starting materials for PCR are double-stranded DNA containing the target nucleotide sequence to be copied, a heat-resistant DNA polymerase, all four nucleotides, and two short, single-stranded DNA molecules that serve as primers. One primer is complementary to one strand at one end of the target sequence; the second is complementary to the other strand at the other end of the sequence. Cycle 1 yields 2 molecules Primers Extension: DNA polymerase adds nucleotidesto the 3 end of each primer Newnucleo-tides RESULTS During each PCR cycle, the target DNA sequence is doubled. By the end of the third cycle, one-fourth of the molecules correspond exactly to the target sequence, with both strands of the correct length (see white boxes above). After 20 or so cycles, the target sequence molecules outnumber all others by a billionfold or more. Cycle 2 yields 4 molecules Cycle 3 yields 8 molecules; 2 molecules (in white boxes) match target sequence Figure 20.7 • The PCR procedure

  26. PCR • a specific seq is targeted using primers to flank the seq • You mix the DNA of the organism, primers for each end of the seq, DNA pol, nucleotides, & buffer • 1. Denaturation: heat briefly to separate strands • 2. Annealing: cool to allow primers to make H-bonds w/target ends of the seq • 3. Extension: DNA pol adds nt’s to 3’ end of each primer

  27. 20.2: Restriction fragment analysis detects DNA diff’s that affect restriction sites • Restriction fragment analysis • Can rapidly provide useful comparative info about DNA seq’s

  28. 1 2 TECHNIQUE RESULTS APPLICATION When the current is turned on, the negatively charged DNA molecules move toward the positive electrode, with shorter molecules moving faster than longer ones. Bands are shown here in blue, but on an actual gel, DNA bands are not visible until a DNA-binding dye is added. The shortest molecules, having traveled farthest, end up in bands at the bottom of the gel. Gel electrophoresis is used for separating nucleic acids or proteins that differ in size, electrical charge, or other physical properties. DNA molecules are separated by gel electrophoresis in restriction fragment analysis of both cloned genes (see Figure 20.9) and genomic DNA (see Figure 20.10). Mixture of DNA molecules of differ- ent sizes Cathode Each sample, a mixture of DNA molecules, is placed in a separate well near one end of a thin slab of gel. The gel is supported by glass plates, bathed in an aqueous solution, and has electrodes attached to each end. Gel Power source Glassplates Anode Longermolecules Gel electrophoresis separates macromolecules on the basis of their rate of movement through a gel in an electric field. How far a DNA molecule travels while the current is on is inversely proportional to its length. A mixture of DNA molecules, usually fragments produced by restriction enzyme digestion, is separated into “bands”; each band contains thousands of molecules of the same length. Shortermolecules After the current is turned off, a DNA-binding dye is added. This dye fluoresces pink in ultraviolet light, revealing the separated bands to which it binds. In this actual gel, the pink bands correspond to DNA fragments of different lengths separated by electrophoresis. If all the samples were initially cut with the same restriction enzyme, then the different band patterns indicate that they came from different sources. Figure 20.8 Gel Electrophoresis and Southern Blotting • Gel electrophoresis • Separates DNA restriction fragments of diff lengths

  29. DdeI DdeI DdeI DdeI Normal  -globin allele 201 bp Large fragment 175 bp Sickle-cell mutant -globin allele Large fragment 376 bp DdeI DdeI DdeI (a) DdeIrestriction sites in normal and sickle-cell alleles of -globin gene. Sickle-cellallele Normalallele Largefragment 376 bp 201 bp175 bp (b) Electrophoresis of restriction fragments from normal and sickle-cell alleles. Figure 20.9a, b • Restriction fragment analysis • Is useful for comparing 2 diff DNA molecules, such as 2 alleles for a gene

  30. Specific DNA fragments can be identified by Southern blotting • Using labeled probes that hybridize to the DNA immobilized on a “blot” of the gel

  31. APPLICATION Researchers can detect specific nucleotide sequences within a DNA sample with this method. In particular, Southern blotting is useful for comparing the restriction fragments produced from different samples of genomic DNA. TECHNIQUE In this example, we compare genomic DNA samples from three individuals: a homozygote for the normal -globin allele (I), a homozygote for the mutant sickle-cell allele (II), and a heterozygote (III). Heavyweight Nitrocellulose paper (blot) Restriction fragments DNA + restriction enzyme I II III Gel Sponge Papertowels I Normal -globin allele Alkalinesolution II Sickle-cell allele III Heterozygote 3 2 Blotting. 1 Gel electrophoresis. Preparation of restriction fragments. Figure 20.10 • Southern blotting of DNA fragments

  32. RESULTS Probe hydrogen- bonds to fragments containing normal or mutant -globin I II III Radioactively labeled probe for -globin gene is added to solution in a plastic bag I II III Fragment from sickle-cell -globin allele Film over paper blot Fragment from normal -globin allele Paper blot 1 2 Hybridization with radioactive probe. Autoradiography. Because the band patterns for the three samples are clearly different, this method can be used to identify heterozygous carriers of the sickle-cell allele (III), as well as those with the disease, who have two mutant alleles (II), and unaffected individuals, who have two normal alleles (I). The band patterns for samples I and II resemble those observed for the purified normal and mutant alleles, respectively, seen in Figure 20.9b. The band pattern for the sample from the heterozygote (III) is a combination of the patterns for the two homozygotes (I and II).

  33. Restriction Fragment Length Differences as Genetic Markers • Restriction fragment length polymorphisms (RFLPs) • diff’s in DNA seq’s on homologous chromo’s that result in restriction fragments of diff lengths

  34. Specific fragments • Can be detected & analyzed by Southern blotting • 1000’s of RFLPs present throughout euk DNA • Can be genetic markers

  35. 20.3:Entire genomes can be mapped at the DNA level • The Human Genome Project • Seq’d the human genome • Scientists have also sequenced genomes of other organisms • Providing important insights of general biological significance

  36. Chromosome bands Cytogenetic map Chromosome banding pattern and location of specific genes by fluorescence in situ hybridization (FISH) Genetic markers Genes located by FISH 1 Genetic (linkage) mappingOrdering of genetic markers such as RFLPs, simple sequence DNA, and other polymorphisms (about 200 per chromosome) 2 Physical mapping Ordering of large over- lapping fragments cloned in YAC and BAC vectors, followed by ordering of smaller fragments cloned in phage and plasmid vectors Overlappingfragments 3 3 DNA sequencing Determination of nucleotide sequence of each small fragment and assembly of the partial sequences into the com- plete genome sequence …GACTTCATCGGTATCGAACT… Figure 20.11 Genetic (Linkage) Mapping: Relative Ordering of Markers • 1st stage in mapping a large genome • make a linkage map of many 1000 genetic markers throughout each of the chromo’s

  37. The order of the markers &the relative distances b/w them on such a map • Are based on recomb freq’s

  38. Physical Mapping: Ordering DNA Fragments • A physical map • Is made by cutting a DNA molecule into many short fragments & arranging them in order by identifying overlaps • Gives the actual distance in base pairs b/w markers

  39. DNA Sequencing • Relatively short DNA fragments • Can be seq’d by the dideoxy chain-termination method

  40. DNA (template strand) Primer Deoxyribonucleotides Dideoxyribonucleotides (fluorescently tagged) 3 T G T T 5 APPLICATION RESULTS C T G A C T T C G A C A A dATP ddATP 5 dCTP ddCTP The sequence of nucleotides in any cloned DNA fragment up to about 800 base pairs in length can be determined rapidly with specialized machines that carry out sequencing reactions and separate the labeled reaction products by length. DNA polymerase dTTP ddTTP dGTP ddGTP P P P P P P G G OH H 3 TECHNIQUE This method synthesizes a nested set of DNA strands complementary to the original DNA fragment. Each strand starts with the same primer and ends with a dideoxyribonucleotide (ddNTP), a modified nucleotide. Incorporation of a ddNTP terminates a growing DNA strand because it lacks a 3’—OH group, the site for attachment of the next nucleotide (see Figure 16.12). In the set of strands synthesized, each nucleotide position along the original sequence is represented by strands ending at that point with the complementary ddNT. Because each type of ddNTP is tagged with a distinct fluorescent label, the identity of the ending nucleotides of the new strands, and ultimately the entire original sequence, can be determined. Labeled strands DNA (templatestrand) 3 5 ddG A C T G A A G C T G T T C T G A C T T C G A C A A ddA C T G A A G C T G T T ddC T G A A G C T G T T ddT G A A G C T G T T ddG A A G C T G T T ddA A G C T G T T ddA G C T G T T ddG C T G T T ddC T G T T 3 Direction of movement of strands The color of the fluorescent tag on each strand indicates the identity of the nucleotide at its end. The results can be printed out as a spectrogram, and the sequence, which is complementary to the template strand, can then be read from bottom to top. (Notice that the sequence here begins after the primer.) Laser Detector G A C T G A A G C Figure 20.12 • Dideoxy chain-termination method for sequencing DNA

  41. Linkage mapping, physical mapping, & DNA sequencing • Represent the overarching strategy of the Human Genome Project • An alternative approach to sequencing whole genomes starts with the seq’ing of random DNA fragments • Powerful computer programs would then assemble the resulting very large # of overlapping short seq’s into a single continuous seq

  42. 1 2 3 4 Cut the DNA from many copies of an entire chromosome into overlapping frag- ments short enough for sequencing. Clone the fragments in plasmid or phage vectors Sequence each fragment ACGATACTGGT CGCCATCAGT ACGATACTGGT Order the sequences into one overall sequence with computer software. AGTCCGCTATACGA Figure 20.13 …ATCGCCATCAGTCCGCTATACGATACTGGTCAA…

  43. 20.4: Genome seq’s provide clues to important biological questions • In genomics • Scientists study whole sets of genes & their interactions

  44. Identifying Protein-Coding Genes in DNA Sequences • Computer analysis of genome sequences • Helps researchers identify seq’s that are likely to encode proteins

  45. Table 20.1 • Current estimates are that the human genome contains about 25,000 genes • But the # of human proteins is much larger

  46. Comparison of the seq’s of “new” genes • W/ those of known genes in other spp may help identify new genes

  47. Determining Gene Function • For a gene of unknown function • Experimental inactivation of the gene & observation of the resulting phenotypic effects can provide clues to its function

  48. Studying Expression of Interacting Groups of Genes • DNA microarray assays allow researchers to compare patterns of gene expression • In diff tissues, at diff times, or under diff conditions

  49. 1 3 2 4 With this method, researchers can test thousands of genes simultaneously to determine which ones are expressed in a particular tissue, under different environmental conditions in various disease states, or at different developmental stages. They can also look for coordinated gene expression. APPLICATION TECHNIQUE RESULT Tissue sample mRNA molecules Isolate mRNA. Make cDNA by reverse transcription, using fluores-cently labeled nucleotides. Labeled cDNA molecules (single strands) Apply the cDNA mixture to a microarray, a microscope slide on which copies of single-stranded DNA fragments from the organism‘s genes are fixed, a different gene in each spot. The cDNA hybridizes with any complementary DNA on the microarray. Rinse off excess cDNA; scan microarray for fluorescence. Each fluorescent spot (yellow) represents a gene expressed in the tissue sample. DNA microarray The intensity of fluorescence at each spot is a measure of the expression of the gene represented by that spot in the tissue sample. Commonly, two different samples are tested together by labeling the cDNAs prepared from each sample with a differently colored fluorescence label. The resulting color at a spot reveals the relative levels of expression of a particular gene in the two samples, which may be from different tissues or the same tissue under different conditions. Size of an actual DNA microarray with all the genes of yeast (6,400 spots) Figure 20.14 • DNA microarray assay of gene expression levels

  50. Comparing Genomes of Different Species • Comparative studies of genomes from related and widely divergent species • Are providing valuable information in many fields of biology

More Related