freya
Uploaded by
2 SLIDES
266 VUES
20LIKES

Legend

DESCRIPTION

Legend. 1. FOLFIRI Non-responder (8) 2. FOLFIRI Responder (10). Crea et al. Suppl. Fig. 1: list of PcG targets down-regulated in FOLFIRI non-responder vs. responder patients.

1 / 2

Télécharger la présentation

Legend

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Legend 1. FOLFIRI Non-responder (8) 2. FOLFIRI Responder (10) Crea et al. Suppl. Fig. 1: list of PcG targets down-regulated in FOLFIRI non-responder vs. responder patients. For analysis settings, see “Material and Methods”. Using our filters, we found 2 significant overlaps: one relative to gene expression changes after exposure to 5-fluorouracil in rectal cancer (Clarke-Colon data set), and one relative to response to FOLFIRI regimen in mCRC patients (Graudens-Colon data set). In the latter case, gene expression analysis was performed on primary tumors and metastasis of chemotherapy-naïve patients. All patients were treated with FOLFIRI regimen. Responders and non-responders were classified according to WHO criteria. Since we aimed at investigating mCRC patients treated with a currently employed chemotherapy regimen, we focused on the latter data set. The figure shows that most PcG targets are silenced in FOLFIRI non-responders (p<0.01, Oncomine analysis).

  2. T ALLELE: TTTGTTATTTTCTCTTTTTTGAAATATGCTTC XBP1 BINDING C ALLELE: TTTGTTATTTTCTCTTTTTTGAAATACGCTTC NO XBP1 BINDING Crea et al. Suppl. Fig. 2: Characterization of TF binding sites affected by rs3757441 SNP. Prediction on XBP binding are performed through PROMO3.0 software, as described in “Materials and Methods”. In red, XBP consensus sequence.

More Related