1 / 27

DAY 2 Theoretical and Methodological Extensions of Competitive Dynamics Research

Explore theoretical and methodological extensions in competitive dynamics research using the Awareness-Motivation-Capability (AMC) perspective. Delve into competitive actions of industry giants Coca-Cola and Pepsi to gain insights on organizational and industry characteristics, action-reaction dyads, and multi-market competition. Analyze strategic simplicity, complexity, predictability, and conformity across observed sequences to understand competitive behaviors. Examine methodological advances and predictive theories to enhance comprehension of competitive actions and performance outcomes. Engage in advocacy presentations to discuss research articles and identify gaps for future exploration.

gaenor
Télécharger la présentation

DAY 2 Theoretical and Methodological Extensions of Competitive Dynamics Research

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. DAY 2 Theoretical and Methodological Extensions of Competitive Dynamics Research

  2. Theoretical Extensions Awareness-Motivation-Capability (AMC) Perspective Awareness TMT Demography & Performance Distress Action Performance Capability Motivation Global Multi-market Competition Inter- organizational Networks

  3. Theoretical Extensions • What are most important theoretical or conceptual extensions? • Do we better understand “how” or “why” competitive action occurs? • Have we moved toward a predictive theory of competitive dynamics? • What more do we need?

  4. Competitive Outcomes Coke’s Actions Pepsi’s Action Rivalry a b c d e a b c d e Organizational Characteristics Industry Characteristics

  5. Action-Reaction Dyads Action Pair 1 Action Pair 2 Action Pair 3 Action Pair 4 b b b a Coca-Cola Pepsi c a c e

  6. Prior Studies: Action “Repertoires” b b b b b Coca-Cola c a b Year-End Tallies Pepsi c e time

  7. Music as Metaphor for Competitive Behavior Sequence of Competitive Actions Sequence of Musical Notes MKT MKT PRICE PROD SVC MKT PRICE time

  8. Notes • Pitch • Volume • Dynamics • Duration • Voice Like individual competitive actions

  9. Chords, Arpeggios • Harmonic anchor • Harmonic interval • or proximity • Harmonic sequence Like pairs or combinations of competitive actions

  10. Melody • Timing, rhythm • Simplicity • Movement • Predictability • Familiarity • Phrasing • Motif Like a meaningful, coherent series of competitive actions

  11. Notes • Pitch • Volume • Dynamics • Duration • Voice • Melody • Timing, rhythm • Simplicity • Movement • Predictability • Familiarity • Phrasing • Motif • Chords, Arpeggios • Harmonic anchor • Harmonic proximity • Harmonic sequence Music as metaphor for competitive behavior

  12. Sequences COMPUTER PROGRAM: data actions2; subj = _n_; do i = 1 to max; output = matrix; end; run; DNA: BOXING: Jab...Jab…Uppercut LANGUAGE: qcheaTiueissesne. hsiT si a cesneueq. This is a sequence. CAGTACATAGTACGATACGA MUSIC:

  13. Sequences in Competitive Interaction • Ordered sample of things • Logically unified sequence • Succession of market-based decisions • Patterns in stream of behaviors • Coordinated series of actions • Actions in a sequential strategic thrust

  14. Competitive Outcomes Coke’s Actions Pepsi’s Action Rivalry a b c d e a b c d e Organizational Characteristics Industry Characteristics

  15. Competitive Actions Over Time Coke Pepsi a a a b b b c c c d d e e d c e a a b a b c d e c b Observed Sequence Observed Sequence

  16. Pepsi Strategic Simplicity a a a a a a a 7 b 1 c c 2 2 d d e 1 a d a c c a e a d b a a c Observed Sequence of Pepsi’s Competitive Actions

  17. Coke Strategic Complexity a a a 3 b b 2 c c c 3 d d d 3 e e 2 a d d e c a c c d b b a e Observed Sequence of Coke’s Competitive Actions

  18. Pepsi Strategic Predictability Pepsi in time1 Pepsi in time2 a a a b b c c c d d b e e a d a b c e a d b c c e e Observed Sequence Observed Sequence

  19. Coke Strategic Unpredictability Coke in time1 Coke in time2 a a a b b b c c c d d e e a d a b c e d b b c c e a Observed Sequence Observed Sequence

  20. Pepsi Strategic Conformity Pepsi Industry Norm a a a b b b c c c d d e e e a b d e c a a b c d c b Observed Sequence Observed Sequence

  21. Coke Strategic Non-Conformity Coke Industry Norm a a a b b b c c c d d e e d c e a a b a b c d e c b Observed Sequence Observed Sequence

  22. Coke Strategic Chunking – Low Separation Scores a a a b b b c c c d d e e a d b e c a c b d b a e c Observed Sequence of Coke’s Competitive Actions

  23. Pepsi Strategic Disconnectedness a a a b b b c c c d d e e a d a b c a e d b b e c c Observed Sequence of Pepsi’s Competitive Actions

  24. Coke Strategic Motif – High Variance of Precedence Scores a b c d e a d a b c a e d b b e c c Observed Sequence of Competitive Actions

  25. Pepsi Strategic Randomness – Low Variance of Precedence Scores a b c d e a d b e c a c b d b a e c Observed Sequence of Competitive Actions

  26. Methodological Extensions • What are the most important advances in data, levels of aggregation, measures and analytical methods? • Do we now better understand “how” or “why” competitive action occurs? • …and how action relates to performance? • Have we moved toward a predictive theory of competitive dynamics? • What more do we need?

  27. Advocacy Presentations • Three teams – three sets of research articles • Discuss and present (~10 minutes) • General idea/phenomenon, research questions, motivation for these studies • Theoretical reasoning • Key constructs • General hypothesized relationships • General research approach • Data & measures • Analysis approach • Key findings • Overall contribution • What’s missing? …and… What’s next?

More Related