gagan
Uploaded by
19 SLIDES
369 VUES
200LIKES

Why test DNA?

DESCRIPTION

Why test DNA?. DNA Fingerprinting. Match suspect/victim/evidence Convicted felon databases Missing persons investigations Maternity/paternity – kidnapping Military – remains from war Mass disasters – ID victims. Sources of DNA at a Crime Scene. Semen – sexual offences, (sperm head).

1 / 19

Télécharger la présentation

Why test DNA?

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

Playing audio...

  1. Why test DNA? DNA Fingerprinting • Match suspect/victim/evidence • Convicted felon databases • Missing persons investigations • Maternity/paternity – kidnapping • Military – remains from war • Mass disasters – ID victims

  2. Sources of DNA at a Crime Scene Semen – sexual offences, (sperm head) Blood (WBC’s) Bone Marrow – retains DNA for years Hair - if follicle, shaft mtDNA Tissue – flesh/organs decompose quickly, not good Saliva – stamps, envelopes, straw, glass, gum Urine – if blood cells were shed

  3. Nuclear DNA $100-200 per test 24-36 hours for results Shows genetic lineage from both parents Only 1 nucleus per cell Mitochondrial DNA(mtDNA) $1000 per test 1-6 weeks for results Shows only maternal lineage Many mitochondria/cell hours What are the 2 types of DNA? Which type is better for forensic testing?

  4. chromosome cell nucleus Double stranded DNA molecule Individual nucleotides DNA in the Cell

  5. Each nucleotide contains: Nitrogenous Base Phosphate Group Sugar (deoxyribose)

  6. 4 different bases make up the steps of the ladder A Adenine T Thymine G Guanine C Cytosine

  7. Base Pairing Rules G-C A-T Sugar-Phosphate backbone

  8. Each rung on the ladder is called a base-pair 1 base pair (bp) 2 base pair (bp) 3 base pair (bp) How many base-pairs are there in the human genome? ( in 1 nucleus / 46 chromosomes) approximately 3 billion

  9. A C G G T A A G C A T A G C C G T G A G T T T A C C A G

  10. The Genetic Code A series of G’s A’s C’s & T’s DNA Fingerprinting: identifies people by their unique genetic code How much of your DNA is identical to everyone else? 99.4%

  11. Nuclear DNA is in every nucleated cell of the body. • Every body cell has 46 chromosomes. • Every sex cell (egg/sperm) has 23 chromosomes.

  12. Human Karyotype Genome: all genetic material in a nucleus. Humans: 22 pairs of autosomes 1 pair of sex chromosomes X & Y

  13. Organization of the Human Genome • Locus – Specific region (address on a chromosome) • Gene – region that encodes for a protein or a trait • Marker Locus – non-coding region Eye color Dimples Freckles Blood type Non-coding “junk DNA” MOM DAD

  14. Organization of the Human Genome Every gene or locus marker can have alternate forms called alleles Brown eyes Blue eyes Dimples No dimples • For every gene/locus in your DNA you have… 2 alleles. • Homozygous • (same) • Heterozygous (different) Freckles No Freckles Type IB Type IA Non-coding “junk DNA” How do these alleles differ? MOM DAD

  15. DNA (Marker Loci) “junk” • How much? • 95% of genome • Function? • Somewhat unknown • Controls gene expression • Do we all have the same marker loci ? • Yes, but slightly different alleles • Ex: Contains different amounts of tandem repeated segments • GACAGACAGACAGACAGACA Polymorphism – an alternate version DNA (Genes) How much? 5% of genome 30,000 genes Function? Codes for traits & proteins Do we all have the same genes ? Yes, but slightly different alleles Ex: brown, blue, green eyes

  16. STR’s Short Tandem Repeats • (smaller segments with fewer repeats) CGAACGAACGAACGAACGAACGAA CGAA CGAA CGAACGAACGAA VNTR’s Variable Number Tandom Repeats • (larger segments with many repeats) GGACTAATATCTATTCCCTAATATGACTAA AATATTTCGGACTAGATATCTTTCGGACTTA TCTATTCGGGAGCCGCTACCCGTG… …X 1000

  17. A locus marker that includes a tandem repeat sequence can have many different alleles in a population. Ex: Allele 1: (6 repeats) GAACT ATTAATTAATTAATTAATTAATTA CGTGCAGGCT Allele 2: (5 repeats) GAACT ATTAATTAATTAATTAATTA CGTGCAGGCT Allele 3: (7 repeats) GAACT ATTAATTAATTAATTAATTAATTAATTA GTGCAGGCT

  18. C G C C A T G C A T G T G A G C G C G T A C G C C A C T G C A T G C C G G C G G T A C G T A C A C T C G C G C A T G C G G T G A C G T A C G G C C G C C A T G C A T G T G A G C G C G T A C C T C A C T G C A T G C C G G C G G T A C G T A C A C T C G C G C A T G G A G T G A C G T A C G G C Locus # 1 Locus # 2 A T C A G C A T T G A T T G A T T G A T T G A C C C A T A T G T G A G C G C G T A C C T C A C T G C G T A G T C G T A A C T A A C T A A C T A A C T G G G T A T A C A C T C G C G C A T G G A G T G A C C T G T T G A T C A G C A T T G A T T G A T T G A C C C A T A T G T G A G C G C G T A C C T C A C T G C G C A A C T A G T C G T A A C T A A C T A A C T G G G T A T A C A C T C G C G C A T G G A G T G A C C T

  19. This Allelic variation is the basis for forensic DNA testing. • Many polymorphic loci in human genome. • Each locus has many forms (alleles). How do we process and visualize the DNA for comparison? 2 types of DNA Fingerprinting • RFLP (older ) involves STR’s & VNTR’s • PCR (newer) involves STR’s

More Related