gamba
Uploaded by
79 SLIDES
1084 VUES
810LIKES

DNA Analysis

DESCRIPTION

DNA Analysis. Bellringer. What is entomology?. Objectives. Introduction to the characteristics of DNA and DNA analysis. Update. Grades DNA “unit” Written Final 6/4: 40 MC questions Field Final 6/5 Serial Killer Papers (3 pages w/citations) 6/6 Serial Killer Posters 6/13

1 / 79

Télécharger la présentation

DNA Analysis

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. DNA Analysis

  2. Bellringer What is entomology?

  3. Objectives Introduction to the characteristics of DNA and DNA analysis.

  4. Update Grades DNA “unit” Written Final 6/4: 40 MC questions Field Final 6/5 Serial Killer Papers (3 pages w/citations) 6/6 Serial Killer Posters 6/13 CSI scripts/videos

  5. DNA DNA “fingerprinting” is a common way to identify people by their unique genetic code DNA “profiling” is a better way to refer to the process; it has nothing to do with fingers or fingerprints.

  6. DNA Where can you find DNA? DNA is in every nucleated cell of the human body and can be extracted from blood, semen, urine, bone, hair follicles, and saliva.

  7. DNA What types of crimes does DNA evidence help solve? DNA is currently being used to identify the perpetrator in a crime, to identify fathers in paternity cases, and to identify unknown remains.

  8. Aspects of DNA In the nucleus of cells are chromosomes that are inherited from both parents. Chromosomes are long-chain DNA molecules that are tightly bound in a specific structure. DNA (deoxyribonucleic acid) is the hereditary material of most organisms. Held together by hydrogen bonds

  9. Chromosomes

  10. Chromosomes

  11. Fun Fact If all of the DNA in your body was stretched out and put end to end, it would reach to the sun and back more than 600 times!

  12. DNA The human body has approximately 35,000 genes Genes are simply portions of the DNA that code the information required to make specific proteins. Proteins determine human traits and functions.

  13. Genes Each gene has a specific code for a specific body function; they are the fundamental unit of heredity, determining traits from hair color, eye color, and facial features to certain diseases or disorders.

  14. Human Genome Project Began in 1990 Set out to identify all of the genes of humans, and the order they are in. We did it.

  15. DNA Structure • The structure of DNA is important to its function. • An unusual property of DNA is its ability to replicate itself. • It is arranged in a right-handed double helix pattern. • Twisted ladder

  16. DNA Structure • The sides of the helix are the sugar and phosphates groups (acidic properties) • On the inside are the base pairs. • Ladder rungs • The average DNA molecule contains 100 million nucleotide groups.

  17. DNA Structure The order of these pairs is 99.9 percent the same for everyone. The 0.1 percent unique sequence is what makes each human one of a kind!

  18. DNA Genes are different amounts of base pairs (1,000 to several hundred thousand) A chromosome is a single DNA molecule twisted and packed into the nucleus of the cell. The sequence of the nucleotide bases is what determines the proteins that will lead to specific growth, function, and reproduction.

  19. Twins Identical twins share 100 percent identical DNA. Fraternal twins share only 50 percent of their DNA, just like regular siblings. This makes for some twists in crimes!

  20. How you get your DNA

  21. Checkpoint What are chromosomes? How is DNA like a fingerprint?

  22. Forensic Uses of DNA Read pages 340 to 345 in the textbook and answer the following questions: How and when was the first criminal case to use DNA evidence? What type of blood cell contains DNA? How many nuclei are in a single drop of blood? Name 4 uses of DNA profiling What is used to release DNA from the chromosome? What are the four main procedures involved in DNA fingerprinting?

  23. Bellringer Where is DNA located in the body?

  24. Objective Learn how forensic scientist extract DNA from a chromosome

  25. DNA The base pairs of DNA only have two possibilities Adenine –Thymine Guanine-Cytosine Written as A,T,G, & C for short.

  26. Statistical Analysis in DNA Profiling The DNA molecule is hundreds of thousands of base pairs long. If you look at only a fragment of the DNA, what are the chances of someone else having the same size fragments? 1 in 5 million chance of someone else sharing your profile

  27. RFLP Analysis R-Restriction enzymes are used to cut the DNA into F-Fragments that are many different L=Lengths and exhibit P-Polymorphism, which means many shapes. The length of these fragments varies greatly among individuals

  28. RFLP Analysis A DNA sample is placed in a special tank that has an electric charge going across it. An enzyme is added to the tank the cuts the DNA at specific spots. The different lengths of DNA then move across the tank at different speeds depending on their length.

  29. RFLP Analysis

  30. Polymerase Chain Reaction PCR is a lab technique used to “copy and paste” a very small DNA sample Need 50 percent less DNA than what is required for a RFLP test.

  31. PCR Forensic scientists cut the DNA sample long ways, breaking the weak hydrogen bonds Since the base pairs only bond in specific pairs, single bases are added and they automatically attach themselves in the cut DNA sample in the correct order. This process is then repeated until there is enough DNA to complete a RFLP test

  32. PCR Example DNA sample found at crime, but too small to test ACTGCTACGATGCATGCATGCATCAGATCAGTCGATGCATGCAGCTAGCTGATGCATGCTGACTGATGCTAGCTAGCTGATCGTAGCTAGCTGACTGATCGTAGCTAGCTGACGATCGTAGCTAGCTCGACTGATCGTAGCTGACTGATCGTAGCTAGCTGACGAGACGTAGCTAGCTGATGCAGCTGATCGATCGTAGCTCGACGAGCATCGAGCATG

  33. PCR After one split they have 2 times the original DNA After two splits they have 4 times the original DNA After three splits they have 8 times the original DNA After ten splits they have 1024 times the original DNA

  34. Short Tandem Repeats New technique that is becoming more common than RFLP because it takes less time, less of a sample size, and is more exclusionary. STRs are locations on the chromosome that repeats a specific sequence of two to ten base pairs.

  35. STR Thousands of STR sites have been identified They are located on almost every chromosome in the body Easily amplified using PCR

  36. STR Forensic scientists scan 13 DNA regions that vary from person to person They use the data to create a DNA profile of that individual There is an extremely small chance that another person has the same DNA profile for a particular set of regions

  37. STR • STR analysis is now the primary method for genetic profiling • In 1992 the Innocence Project at the Cardozo School of Law started using STR tests to free wrongfully convicted people from jail. • As of January 7th, 2014 312 have been exonerated • As of May 29th , 2014 316 have been exonerated

  38. Checkpoint How can PCR tests help forensic scientists analyze DNA evidence? What is the most common method of genetic profiling?

  39. Mitochondrial DNA Mitochondria is the powerhouse of the cell, providing 90 percent of the energy a human needs to function Each cell contains thousands of mitochondria, each containing several loops of DNA with 15,000-17,00 base pairs. Unlike nuclear DNA, which if found on the chromosomes, mitochondrial DNA (mtDNA) is inherited only from the mother.

  40. MtDNA Usually no change in mtDNA from mother to offspring Individuals with the same maternal lineage are indistinguishable if mtDNA is used for analysis You, your siblings, your Mom, your Mom’s siblings, your Grandma, your Grandma’s siblings, your Great Grandma, your Great Grandma siblings, and so on all share the same mtDNA!

  41. MtDNA Analysis techniques are more sensitive than other profiling techniques, more costly, and takes more time. Cases in which hairs, bones, or teeth are the only evidence retrieved from a crime scene are particularly well-suited to mtDNA analysis.

  42. Fake DNA Is it possible to fake your DNA results? Dentist raped his patient when she was sedated. He installed a drain in his body with someone else’s blood. This way the DNA from his blood test wouldn’t match the DNA recovered from the woman.

  43. Old Evidence On pages 362 read the story in the blue box, then on page 363 read the case study. How are these two stories similar? How does DNA analysis help solve crimes by using old evidence? Why is it important to build up data bases, and save evidence even after crimes have been cold for years?

  44. Simulation of RFLP –pg 346 Use a meter stick to mark off every 2.5cm on your strip of paper, and then draw a long line all the way down the center. In every 2.5 cm box write four letters in any order, and in any combination that you want (A,T,G,C). After you filled in the top, fill in the bottom with the complementary letter below.

  45. Bellringer What does RFLP stand for?

  46. Objectives Finish our simulated RFLP DNA test. Textbook questions Notes on other DNA analysis

  47. Simulation of RFLP –pg 346 Going left to right make a cut on the top strand at every AT sequence Going right to left make a cut on the bottom strand at every AT sequence Measure each of the fragments with your meter stick and write the length on the back. Fill in the chart, and get data from at least 8 other pairs

  48. Simulation of RFLP –pg 346

More Related