1 / 44

PyroMark ™ Q24 Andrea Tesoriero Application Specialist

PyroMark ™ Q24 Andrea Tesoriero Application Specialist. Agenda. Introduction Pyrosequencing technology Pyrosequecing workflow PyroMark Q24 Instrument System Software AQ workflow Mutation example – KRAS CpG Workflow. What is Pyrosequencing?. Sequencing by Synthesis:

ghada
Télécharger la présentation

PyroMark ™ Q24 Andrea Tesoriero Application Specialist

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. PyroMark™ Q24Andrea TesorieroApplication Specialist

  2. Agenda • Introduction • Pyrosequencing technology • Pyrosequecing workflow • PyroMark Q24 • Instrument • System • Software • AQ workflow • Mutation example – KRAS • CpG Workflow

  3. What is Pyrosequencing? Sequencing by Synthesis: Ronaghi M., Uhlén M., Nyrén P. (1998) Real-Time Pyrophosphate Detection for DNA Sequencing. Science 281:363-365 • Sequence based technology in real time • Simple and robust • No separation, gel, label or probes • In built controls • Flexible • in throughput • in assay design • in type of applications • quantitation

  4. Pyrosequencing Assays Amplification of Region of interest (PCR) Sequencing primer PCR primer Region of interest Biotinylated PCR primer Pyrosequencing Analysis

  5. Pyrosequencing Workflow PCR Sample Preparation – 10 min Pyrosequencing Analysis – 10-60 min/plate

  6. Pyrosequencing WorkflowPCR andSample preparation 1. PCR with one of the primers biotinylated 2. Immobilize biotinylated PCR products onto streptavidin coated beads 3. Separate strands by denaturation in NaOH 4. Wash /neutralize the immobilized strand 5. Anneal sequencing primer 1-2 h 10-15 min Run Pyrosequencing 10-100 min

  7. Pyrosequencing WorkflowSample Preparation Vacuum tool Water Washing buffer Denaturation Solution (NaOH) EtOH PSQ plate with sequencing primer PCR product immobilized on Sepharose beads

  8. Pyrosequencing WorkflowSample preparation 1-24 post-PCR samples prepared in parallel in less than 15 minutes Minimal pipetting Actual hands-on time, less than 1 minute Plastic waste reduced to a minimum

  9. Light Time Pyrosequencing Workflow Enzyme Cascade PPi ATP

  10. Pyrosequencing Workflow A Pyrogram™ is generated

  11. Pyrosequencing Workflow A Pyrogram™ is generated T A GG TTT G C Variable Region Reference Sequence

  12. Single height ref peaks Double height ref peak 2 half height peaks Negative controls Reference Peaks Pyrosequencing Workflow A Pyrogram™ is generated Sequence to Analyse =a/gCTGCCT Genotype=A/G Heterozygote T A C C T G C G T

  13. G C T A G A T G C A G A Pyrosequencing WorkflowUnequivocal genotype classification ACTGCCT --------TGACGGA--- HomozygousA ACTGCCT --------TGACGGA--- GCTGCCT --------CGACGGA--- HomozygousG GCTGCCT --------CGACGGA--- T A A G C G ACTGCCT --------TGACGGA--- HeterozygousA/G GCTGCCT --------CGACGGA---

  14. PyroMarkTM Q24 A complete solution for Mutation and Methylation Analysis CpG methylation Allele quantification Mutation analysis A Small Smart Affordable Pyrosequencing System with a 24 well plate format

  15. PyroMark™ Q24Instrument Design X-Y drive Positioning A C G T Ink jet delivery Reagent cartridge 24 well plate Mixer and thermostat Detection 24 individual CCD Chips

  16. PyroMarkTM Q24 System Reagents Application and Assay Design software Instrument Vacuum Prep. Workstation

  17. PyroMark™ Q24Benefits An extremely easy to use system - Up to 24 samples in parallel Small Footprint Takes very little bench space Measuring only H420xW390xD525mm Robust Can be run at ambient temperatures between 15°C and 32°C. Runs can be set up and analyzed on any PC anywhere, running PyroMark™Q24 Software. Information is transferred between the instrument and computer via a USB memory stick. Conforms to EU IVDD so suitable for clinical use in Europe

  18. PyroMark™ Q24 Software The software has two analysis modes: AQ - A variety of quantification studies and SNP analysis. CpG - Methylation analysis of multiple consecutive CpG sites. AQ assays and CpG assays can be performed on the same PyroMark™ Q24 Plate. 5 multi licenses You can toggle between the analysis modes in the analysis view of the software, by selecting AQ or CpG in the toolbar. Both modes offer detailed report information that can be exported to html, Excel, text and PDF formats.

  19. PyroMark™ Q24 softwareAQ mode Frequency calculations of variable positions in sequence context including; Single variable position AG/TC Multiple variable positions AG/TCAG/TCAG/T/AC Di- Tri- or Tetra-allelic mutations GA/C/G/TA High resolution of individual sites Quality assessment of individual sites and sequence context SNP analysis (Multiple positions, Di- Tri- or Tetra-allelic variants) Analysis of SNPs in the presence of CpG sites

  20. Mutation exampleKRAS • Mutations in the KRAS gene results in a constitutively active KRAS protein which leads to abnormal cell growth, proliferation and differentiation. • KRAS is frequently mutated in • Colorectal cancer • Lung cancer • The most common KRAS mutations are found in codons 12,13 and 61

  21. Seq FP GGT GGC GTAGG Codon 12 & 13 Seq RPB FPB Codon 61 RP TCCA GTT CTC Mutation exampleKRAS – mutation frequency Codon 61 Codon 12+13 = Guanine G 70 7477 = Thymine T = Cytosine C = Adenine A Basepair substitution Basepairsubstitution Flexible assay design facilitates analysis of contiguous, multivariable mutations Wt seq C A A G G T G G C

  22. Mutation exampleThe KRAS 2.0 assay G G T G G C C A A A A T A A C A A A C C T G C C C G C G C T A C T Seq FP NNt RVc Codon 12 & 13 T T T G G C RPB FPB Codon 61 BND Seq RP Codons 12 13 61 Wt seq Multi-variable mutations

  23. Efficient detection and quantification of mutations in codons 12, 13 and 61 with built in quality control 1 well/sample for all Codon 12 & 13 mutations (9 reported mutations) 1 well/sample for all Codon 61 mutations (7 reported mutations) Provides high quality data of DNA from fresh, frozen and paraffin-embedded tumor samples Sequence context provides built-in control and eliminates false positives/negatives Mutation exampleThe KRAS 2.0 assay

  24. Mutation exampleThe KRAS assay – Wild Type

  25. Mutation exampleThe KRAS assay – codon 12 position 2 GGT>GCT Gly12Ala GGT>GAT Gly12Asp GGT>GTT Gly12Val

  26. Mutation exampleThe KRAS assay – codon 12 position 1 GGT>TGT Gly12Cys GGT>AGT Gly12Ser

  27. Mutation exampleThe KRAS assay – codons 13 and 61 GGC>GAC Gly13Asp CAA>CAC Gln61His TTG>GTG

  28. Mutation exampleThe KRAS assay – Conclusions • 1 PCR to cover ALL mutations in codons 12 & 13 • Minimises amount of gDNA needed (10ng) • Optional second PCR to cover all mutations in codon 61 • Provides results for rarer but important mutations not covered by other methods • Fast results • PCR product to quantitative result in ~ 30 minutes for 24 samples

  29. 75% 25% CpG methylation analysis mC C • 1. Bisulfite conversion • 2. PCR amplification • 3. Pyrosequencing C U C C T U Degree of methylation is automatically analyzed by the software. mC C

  30. CpG methylation analysisAssay design CpG island Sequencing primer PCR primer CpG sites PCR primer • All primers are located in non-variable regions, in between CpG sites • Enables analysis of several adjacent CpG sites with one sequencing primer • Freedom in positioning of the sequencing primer • distance from CpG site • orientation of assay

  31. CpG methylation analysisA range of analysis possibilities • Any single CpG site • Multiple consecutive CpG sites • One gene at a time • Several genes in the same analysis (analyze up to 24 different assays in one run)

  32. Benefits of Pyrosequencing for CpG methylation analysis • Quantitative analysis of multiple consecutive sites • Flexible assay design • Forward – reverse/ Upper – lower • Flexible primer positioning • Built-in Bisulfite treatment control • Excellent Performance • Accuracy • Precision • Reproducibility over time • Confidently discern even small changes in methylation • Fast results

  33. Benefits of Pyrosequencing for CpG methylation analysis Built-in quality control of bisulfite treatment RASSF1A gene Before bisulfite treatment CCGACATGGCCCGGTTGGGCCCGTGCTTCGCTGGCTTTGGGCGCTAGCAAGCGCGGGCCGGGCGGGGC Analyzed sequence TYGATATGGTTYGGTTGGGTTYGTGTTTYGTTGGTTTTGGGYGTTAGTAAGYGYGGGTYGGGYGGGGT Any C not followed by a G gives bisulfite QC

  34. Benefits of Pyrosequencing for CpG methylation analysis Accuracy - Linear response in measured methylation Normal DNA Colon cancer DNA Linear response of methylation measured by Pyrosequencing in PCR-amplified products generated from controlled dilutions of in-vitro methylated (IVM) genomic DNA with unmethylated DNA (IVM DNA is 80% methylated). Sequence to analyze: GGGTGGGGYGGATYGYGTGYGT

  35. Benefits of Pyrosequencing for CpG methylation analysis Accuracy – using different sequencing primers Methylation levels are consistent even when using different primers Seq. Primer 3 Seq. Primer 2 Seq. Primer 1 MLH1gene 73 bases Each methylation value is the mean of 3 replicates

  36. Benefits of Pyrosequencing for CpG methylation analysis Consistent precision among CpG sites Confidently measure the individual degree of methylation in adjacent CpG sites, even at long distances from the sequencing primer Pos. 1 Pos. 2 Pos. 3 Pos. 4 Pos. 5Pos. 6Pos. 7 Pos. 8 Pos. 9 Pos. 10 MGMT gene

  37. Benefits of Pyrosequencing for CpG methylation analysis Quantification of individual CpG sites Methylation pattern in RASSF1A in neighboring CpG sites in 4 tumor samples (duplicate runs) • Methylation levels may vary from site to site • Pyrosequencing detects site variation reproducibly

  38. Imprinting • Gene expression dependent on the parent of origin • Prader-Willi Syndrome (PWS)Angelman Syndrome (AS) • Neuro developmental disorders caused by a deficiency with 15q parental contributions • methylated on the maternal chromosome • remains unmethylated on paternal chromosome • PWS: lack of paternal contribution • paternal deletion (70%) • maternal uniparental disomy (25%) • AS: lack of a maternal contribution • maternal deletion (70%) • paternal uniparental disomy (5%) (UPD-receive two copies of a chromosome from one parent)

  39. Benefits of Pyrosequencing for CpG methylation analysis Flexible assay design Analysis in either direction – Prader Willi/Angelman Forward assay: C/T Reverse assay: G/A

  40. Software Overview

  41. PyroMark™ product lineCancer mutations, methylation, clinical genetics Genetic tests that show real sequence information. • PyroMark RUO • Optimized PCR and Pyrosequencing protocols, built-in quality control • Cancer Mutations: KRAS, BRAF • CpG Methylation: p16, MLH1, LINE-1, MGMT • Clinical Genetics: APOE, HFE, MTHFR, Prader-Willi/Angelman • PyroMark Assay Database • over 1,000 optimized & wet-tested assay designs • Continuous updates • Online access: www.pyrosequencing.com/techsupport

  42. PyroMark product line Product Offering Overview Reagents Assay Kits Software PyroMark Q96 MD Instruments PyroMark Q96 ID PyroMark Q24 Workstation Sample preparation PyroMark Q24

  43. Genetic Variation • SNP & mutation analysis • Simplex & multiplex SNP genotyping • Tri/tetra-allelic mutations • Quantification • CpG methylation analysisAnalysis of polyploid genomesAllele-specific gene expressionSNP pooling studiesViral/bacterial loadLoss of heterozygosityGene copy number Short DNA sequencing Microbial identification Species discrimination Sub-typing Resistance detection Sequence signaturesDNA bar-codingSequence variationSequence verificationForensicsClone checking

  44. Gracias por su atención

More Related