gibson
Uploaded by
43 SLIDES
646 VUES
440LIKES

Ecclesiastes 3:1

DESCRIPTION

Ecclesiastes 3:1 1 To every thing there is a season, and a time to every purpose under the heaven:. Initiation of Transcription. Timothy G. Standish, Ph. D. All Genes Can’t be Expressed At The Same Time.

1 / 43

Télécharger la présentation

Ecclesiastes 3:1

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Ecclesiastes 3:1 1 To every thing there is a season, and a time to every purpose under the heaven:

  2. Initiation of Transcription Timothy G. Standish, Ph. D.

  3. All Genes Can’t be Expressed At The Same Time • Some gene products are needed by all cells all the time. These constitutive genes are expressed by all cells. • Other genes are only needed by certain cells or at specific times, expression of these inducible genes is tightly controlled in most cells. • For example, pancreatic b cells make insulin by expressing the insulin gene. If neurons expressed insulin, problems would result.

  4. Operons Are Groups Of Genes Expressed By Prokaryotes • The genes grouped in an operon are all needed to complete a given task • Each operon is controlled by a single control sequence in the DNA • Because the genes are grouped together, they can be transcribed together then translated together

  5. The Lac Operon • Genes in the lac operon allow E. coli bacteria to metabolize lactose • Lactose is a sugar that E. coli is unlikely to encounter. Production of lactose metabolizing enzymes when not needed would be wasteful • Metabolizing lactose for energy only makes sense when two criteria are met: • Other more readily metabolized sugar (glucose) is unavailable • Lactose is available

  6. The Lac Operon - Parts • The lac operon is made up of a control region and four genes • The four genes are: • LacZ -b-galactosidase - Hydrolizes the bond between galactose and glucose • LacY - Codes for a permease that lets lactose across the cell membrane • LacA - Transacetylase - An enzyme whose function in lactose metabolism is uncertain • Repressor - A protein that works with the control region to control expression of the operon

  7. The Lac Operon - Control • The control region is made up of two parts: • Promoter • These are specific DNA sequences to which RNA Polymerase binds so that transcription can occur • The lac operon promoter also has a binding site for another protein called CAP • Operator • The binding site of the repressor protein • The operator is located downstream (in the 3’ direction) from the promoter so that if repressor is bound RNA Polymerase can’t transcribe

  8. Hey man, I’m constitutive Repressor Promoter LacZ LacY LacA CAP Binding Repressor Repressor Repressor mRNA Operator CAP The Lac Operon:When Glucose Is Present But Not Lactose Come on, let me through RNA Pol. No way Jose!

  9. Hey man, I’m constitutive RNA Pol. Repressor Promoter LacZ LacY LacA X CAP Binding Repressor Repressor Repressor mRNA Repressor Operator CAP The Lac Operon:When Glucose And Lactose Are Present Great, I can transcribe! RNA Pol. Lac This lactose has bent me out of shape Some transcription occurs, but at a slow rate

  10. Hey man, I’m constitutive RNA Pol. Repressor Promoter LacZ LacY LacA X CAP CAP CAP Binding Repressor Repressor Repressor mRNA cAMP cAMP cAMP Repressor Operator CAP The Lac Operon:When Lactose Is Present But Not Glucose Bind to me Polymerase Yipee…! RNA Pol. Lac This lactose has bent me out of shape

  11. Alright, I’m off to the races . . . Hey man, I’m constitutive Repressor Promoter LacZ LacY LacA CAP CAP CAP Binding Repressor Repressor Repressor mRNA cAMP cAMP cAMP Operator CAP The Lac Operon:When Neither Lactose Nor Glucose Is Present Bind to me Polymerase Come on, let me through! RNA Pol. STOP Right there Polymerase

  12. The Trp Operon • Genes in the trp operon allow E. coli bacteria to make the amino acid tryptophan • Enzymes encoded by genes in the trp operon are all involved in the biochemical pathway that converts the precursor chorismate to tryptophan. • The trp operon is controlled in two ways: • Using a repressor that works in exactly the opposite way from the lac operon repressor • Using a special attenuator sequence

  13. 5-Phosphoribosyl- a-Pyrophosphate Glutamine Glutamate + Pyruvate PPi COO- COO- NH2 -OOC Anthranilate synthetase CH2 O C COO- Anthranilate synthetase (trpE and D) HN N-(5’- Phosphoribosyl) -anthranilate O CH2 -2O3P Chorismate H Antrhanilate O H H HO N-(5’-Phosphoribosyl)-anthranilate isomerase Indole-3’-glycerol phosphate synthetase (trpC) H H H OH OH OH OH OH OH CO2+H2O -2O3PO CH2 -OOC C C C -2O3PO CH2 C C C OH N-(5’-Phosphoribosyl)- Anthranilate isomerase Indole- 3’-glycerol phosphate synthetase H H Enol-1-o- Carboxyphenylamino -1-deoxyribulose phosphate C H H H C H H N H N H Tryptophan synthetase (trpB and A) Indole-3-glycerol phosphate -OOC C CH2 Glyceraldehyde- 3-phosphate NH3+ Serine H2O N H N H Tryptophan synthetase Indole Tryptophan The TryptophanBiochemical Pathway

  14. Hey man, I’m constitutive Repressor Promo. Lead. Aten. trpE trpD trpC trpB trpA Repressor Repressor mRNA Operator Trp Trp Repressor The Trp Operon:When Tryptophan Is Present Foiled Again! RNA Pol. STOP Right there Polymerase

  15. Hey man, I’m constitutive RNA Pol. Repressor Promo. Lead. Aten. trpE trpD trpC trpB trpA Repressor mRNA Operator Repressor The Trp Operon:When Tryptophan Is Absent RNA Pol. Repressor needs his little buddy tryptophan if I’m to be stopped I need tryptophan

  16. Attenuation • The trp operon is controlled both by a repressor and attenuation • Attenuation is a mechanism that works only because of the way transcription and translation are coupled in prokaryotes • Therefore, to understand attenuation, it is first necessary to understand transcription and translation in prokaryotes

  17. 5’ 3’ 3’ 5’ RNA Pol. Ribosome mRNA Ribosome 5’ Transcription And Translation In Prokaryotes

  18. 1 2 3 4 The Trp Leader and Attenuator Met-Lys-Ala-Ile-Phe-Val- AAGUUCACGUAAAAAGGGUAUCGACA-AUG-AAA-GCA-AUU-UUC-GUA- Leu-Lys-Gly-Trp-Trp-Arg-Thr-Ser-STOP CUG-AAA-GGU-UGG-UGG-CGC-ACU-UCC-UGA-AACGGGCAGUGUAUU CACCAUGCGUAAAGCAAUCAGAUACCCAGCCCGCCUAAUGAGCGGGCUUUU Met-Gln-Thr-Gln-Lys-Pro UUUU-GAACAAAAUUAGAGAAUAACA-AUG-CAA-ACA-CAA-AAA-CCG trpE . . . Terminator

  19. 1 2 1 2 3 3 4 4 The mRNA Sequence Can Fold In Two Ways Terminator hairpin

  20. 5’ 3’ 3’ 5’ 2 3 Ribosome 4 1 The Attenuator When Starved For Tryptophan RNA Pol. Help, I need Tryptophan

  21. 5’ 3’ 3’ 5’ Ribosome 2 3 4 1 The Attenuator When Tryptophan Is Present RNA Pol. RNA Pol.

  22. Expression Control In Eukaryotes • Some of the general methods used to control expression in prokaryotes are used in eukaryotes, but nothing resembling operons is known • Eukaryotic genes are controlled individually and each gene has specific control sequences preceding the transcription start site • In addition to controlling transcription, there are additional ways in which expression can be controlled in eukaryotes

  23. Eukaryotes Have Large Complex Genomes • The human genome is about 3 x 109 base pairs or ≈ 1 m of DNA • Because humans are diploid, each nucleus contains 6 x 109 base pairs or ≈ 2 m of DNA • Some gene families are located close to one another on the same chromosome • Genes with related functions appear to be distributed almost at random throughout the the genome

  24. Highly Packaged DNA Cannot be Expressed • Because of its size, eukaryotic DNA must be packaged • Heterochromatin, the most highly packaged form of DNA, cannot be transcribed; therefore expression of genes is prevented • Chromosome puffs on some insect chomosomes illustrate areas of active gene expression

  25. Only a Subset of Genes is Expressed at any Given Time • It takes lots of energy to express genes • Thus it would be wasteful to express all genes all the time • By differential expression of genes, cells can respond to changes in the environment • Differential expression, allows cells to specialize in multicelled organisms. • Differential expression also allows organisms to develop over time.

  26. Cytoplasm Nuclear pores Degradation AAAAAA AAAAAA DNA Transcription Modification RNA RNA Processing G G Degradation etc. Ribosome mRNA G AAAAAA Export Translation Nucleus Control of Gene Expression Packaging Transportation

  27. Increasing cost Logical Expression Control Points The logical place to control expression is before the gene is transcribed • DNA packaging • Transcription • RNA processing • mRNA Export • mRNA masking/unmasking and/or modification • mRNA degradation • Translation • Protein modification • Protein transport • Protein degradation

  28. Three Eukaryotic RNA Polymerases • RNA Polymerase I - Produces rRNA in the nucleolus, accounts for 50 - 70 % of transcription • RNA Polymerase II - Produces mRNA in the nucleoplasm - 20 - 40 % of transcription • RNA Polymerase III - Produces tRNA in the nucleoplasm - 10 % of transcription

  29. Transcription Start Site 3’ Untranslated Region 5’ Untranslated Region Introns 5’ 3’ Int. 1 Int. 2 Exon 1 Exon 2 Exon 3 Promoter/ Control Region Terminator Sequence Exons RNA Transcript A “Simple” Eukaryotic Gene

  30. DNA 5’ 3’ Enhancer Promoter Transcribed Region 3’ 5’ TF 3’ 5’ TF TF RNA Pol. RNA Pol. RNA 5’ Enhancers Many bases TF TF TF

  31. Eukaryotic RNA Polymerase II • RNA polymerase is a very fancy enzyme that does many tasks in conjunction with other proteins • RNA polymerase II is a protein complex of over 500 kD with more than 10 subunits:

  32. Eukaryotic RNA Polymerase II Promoters • Several sequence elements spread over about 200 bp upstream from the transcription start site make up RNA Pol II promoters • Enhancers, in addition to promoters, influence the expression of genes • Eukaryotic expression control involves many more factors than control in prokaryotes • This allows much finer control of gene expression

  33. Promoter T. F. RNA Pol. II T. F. RNA Pol. II mRNA 5’ Initiation T. F.

  34. Exon 1 Promoter 5’ Sequence elements TATA ~200 bp Transcription start site “TATA Box” Initiator SSTATAAAASSSSSNNNNNNNNNNNNNNNNNYYCAYYYYYNN -1+1 S = C or G Y = C or T N = A, T, G or C Eukaryotic Promoters (Template strand) ~-25

  35. TFIID TBP Associated Factors (TAFs) Transcription start site InitiationTFIID Binding “TATA Box” -1+1 TATA Binding Protein (TBP)

  36. 80o Bend Transcription start site InitiationTFIID Binding TFIID -1+1

  37. TFIIB Transcription start site InitiationTFIIA and B Binding TFIID -1+1 TFIIA

  38. TFIIB Transcription start site InitiationTFIIF and RNA Polymerase Binding TFIID -1+1 TFIIA RNA Polymerase TFIIF

  39. TFIIB Transcription start site InitiationTFIIE Binding TFIIE TFIID RNA Polymerase TFIIF -1+1 TFIIA TFIIE has some helicase activity and may by involved in unwinding DNA so that transcription can start

  40. TFIIH TFIIB P P P Transcription start site InitiationTFIIH and TFIIJ Binding TFIIJ TFIIE TFIID RNA Polymerase TFIIF -1+1 TFIIA TFIIH has some helicase activity and may by involved in unwinding DNA so that transcription can start

  41. TFIIH TFIIB P P P Transcription start site InitiationTFIIH and TFIIJ Binding TFIIJ TFIIE TFIID TFIIF RNA Polymerase -1+1 TFIIA

  42. P P P Transcription start site InitiationTFIIH and TFIIJ Binding RNA Polymerase -1+1

  43. The End

More Related