gladys
Uploaded by
35 SLIDES
552 VUES
350LIKES

Dynamic Competitive Interaction: Implications for Strategy and Competitive Intelligence

DESCRIPTION

Dynamic Competitive Interaction: Implications for Strategy and Competitive Intelligence. Consequences of Cutthroat Rivalry. Lynagh’s. Two Keys Tavern. Two Keys Tavern. Prisoner’s Dilemma. Criminal 2. Squeal. Clam Up. #2 Serves 10 Years #1 Goes Free. Both Serve 5 Years. Squeal.

1 / 35

Télécharger la présentation

Dynamic Competitive Interaction: Implications for Strategy and Competitive Intelligence

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

Playing audio...

  1. Dynamic Competitive Interaction: Implications for Strategy and Competitive Intelligence

  2. Consequences of Cutthroat Rivalry Lynagh’s Two Keys Tavern Two Keys Tavern

  3. Prisoner’s Dilemma Criminal 2 Squeal Clam Up #2 Serves 10 Years #1 Goes Free Both Serve 5 Years Squeal Criminal 1 #1 Serves 10 Years #2 Goes Free Both Serve 1 Year Clam Up

  4. What Price a Dollar? • $1.00 will be auctioned off • Opening bid is 10¢ • Bids increase in 10¢ increments • Highest bidder wins $1.00 • Top two bidders must pay auctioneer

  5. Three Stooges • Larry, Curley and Moe are in a 3-way duel and agree to take turns shooting each other in that order • Accuracy statistics: • Larry hits intended target 20% of the time • Curley hits intended target 80% of the time • Moe hits intended target 100% of the time • What should Larry do?

  6. The Playbook: What will they run next?

  7. Complex Rivalry: Where to move?

  8. Competitive Outcomes Firm 1 Actions Competitive Interaction Firm 2 Actions Organizational Characteristics Industry Characteristics

  9. Competitive Dynamics • Observe competitive moves • Organize competitive moves • Action/response pairs • Action repertoires (year-end tallies) • Competitive attacks/sequences • Measurement/Analysis of Characteristics • Four key action pattern characteristics that improve: • Market share • Stock price • Profitability

  10. Externally-directed, observable competitive moves carried out to improve relative competitive position: Strategy as Action Generic Actions: Pricing Marketing Products Service Capacity Signals Other Studies: Airlines Telecom Brewing PCs Software Mutual Funds 41 Industries Actions symbolically represented as these

  11. Action Response Action-Reaction “Pairs” Action Pair 1 Action Pair 2 Action Pair 3 Action Pair 4 Company 1 Company 2 • Profits • Growth • Mkt. Share time

  12. Type Implementation Requirement Radicality Irreversibility Action-Reaction “Pairs” Action Pair 1 Action Pair 2 Action Pair 3 Action Pair 4 Company 1 Company 2 time • Likelihood • Speed (delay) • Matching

  13. Profits Growth Mkt. Share Action Repertoire Prior Studies: Action “Repertoires” Company 1 Year-End Tallies Company 2 time

  14. Profits Growth Mkt. Share Total Actions Complexity Prior Studies: Action “Repertoires” Company 1 Year-End Tallies Company 2 time

  15. Named Sequences: Epaulette’s Mate Sicilian Defense Sequential Competitive Interaction ? 8 7 6 5 4 3 2 1 • This Sequence: • Black: Knight b4 • White: Pawn c3 • Black: Bishop g4 • White: Queen b5 • Black: Pawn c5 a b c d e f g h

  16. Sequence Applications... COMPUTER PROGRAM: data actions2; subj = _n_; do i = 1 to max; output = matrix; end; run; DNA: BOXING: Jab...Jab…Uppercut LANGUAGE: qcheaTiueissesne. hsiT si a cesneueq. This is a sequence. CAGTACATAGTACGATACGA MUSIC:

  17. Sequences in Competitive Interaction • Ordered sample of things • Temporal orderliness among elements • Logically unified sequence • Succession of market-based decisions • Patterns in stream of behaviors • Coordinated series of actions • Actions in a sequential strategic thrust

  18. Competitive Attack: Sequence of Actions Action Sequence 1 Action Sequence 2 time Competitive Attack • Profits • Growth • Mkt. Share

  19. Time Focal Firm • Avg. Attack Volume (a + a’) • No. of Actions per Attack • Avg. Attack Duration (a + a’) • No. days firm sustains attack MKT MKT PRICE MKT PRICE (a) (a’) Rival Firm PROD SVC

  20. Time Period 1 MKT MKT PRICE PROD MKT MKT PRICE • Attack Unpredictability • Resemblance of two attack sequences MKT PRICE PROD SIG PRICE MKT Time Period 2 Time

  21. Focal Firm’s Stock Price and/or Market Share Gain MKT MKT CAP SIG PROD PRICE MKT MKT MKT PROD Attack a Attack a’ • Focal Firm’s Competitive Attack • Attack Volume • Attack Duration • Attack Complexity • Attack Unpredictability

  22. Group Exercise: Bud vs. Miller • Total Actions • Count of total actions • Average Response Time • Avg. number of time units between last competitive move and first competitive response • Repertoire Complexity • Extent to which repertoire is skewed vs. balanced • Attack Unpredictability • Lack of discernable action combinations or repetition

  23. Action/Response Pairs Implementation Req. Irreversibility Radicality • Response: • Less Likely • Slower Action Characteristics Better Profitability for Attacker

  24. Competitive Repertoire and Market Share Gain Market Share Gain More Actions Complexity Faster Avg. Response Speed Action Repertoire Characteristics

  25. Competitive Attack and Market Share Gain Market Share Gain Attack Volume Attack Duration Competitive Attack Characteristics

  26. Competitive Attack and Market Share Gain Market Share Gain Simple Complex Extent of Attack Complexity

  27. Competitive Attack and Market Share Gain Market Share Gain Predictable Unpredictable Extent of Attack Unpredictability

  28. Results: Attack Intensity Stock Price Sporadic, Infrequent Intense, Sustained Number of Actions within Sustained Attack per Unit Time Results reversed for relationship between focal firm’s attack and rival’s stock price.

  29. Results: Attack Complexity Stock Price Simple Complex Extent to which Focal Firm’s Attacks Consist of Actions of Many Types

  30. Post Hoc: Attack Unpredictability Rival’s Stock Price Predicable, Inertia Unpredictable, Change Extent of Change in Focal Firm’s Sequence of Actions

  31. Scoring the Fight Total Actions Faster Responses More Complex Repertoire Unpredictable Attacks MillerBud

  32. Too much of a good thing?Lynagh’s vs. Two Keys Market Share Gains Performance • Profitability Competitive Aggressiveness

  33. Rivals’ prior behavior Patterns Tendencies Type & order of moves Proactiveness Reactiveness Drivers of Behavior Management orientation Decision-making Financial constraints Industry characteristics Implications for CI:Predict Future Behavior of Rivals

  34. Implications for CI:Monitor Your Own Behavior • Objective measures of competitive behavior • Safeguard against complacency, predictability, simplicity • Keep rivals off balance / disruption • Identify factors that facilitate aggressiveness • What combinations of moves are effective? …which are ineffective? …smoke signals?

  35. Conclusions and Implications • Managerial Implications • Incorporate dynamic analysis of competitive moves into competitive intelligence program • Assists managers to make inform choices about the requisite level of competitive behavior • Use stock returns as an important decision-making tool and as a messenger

More Related