gomer
Uploaded by
27 SLIDES
479 VUES
280LIKES

Coding Documents using Alternative Techniques

DESCRIPTION

Coding Documents using Alternative Techniques. Mircea-Florin Vaida, Tatiana Hodorogea Technical University of Cluj-Napoca, Baritiu Street No.26-28, 400027, Cluj-Napoca, Romania Mircea.Vaida@com.utcluj.ro, thodorogea@yahoo.com. Content. 1. Introduction 2. DNA Steganography

1 / 27

Télécharger la présentation

Coding Documents using Alternative Techniques

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Coding Documents using Alternative Techniques Mircea-Florin Vaida, Tatiana Hodorogea Technical University of Cluj-Napoca, Baritiu Street No.26-28, 400027, Cluj-Napoca, Romania Mircea.Vaida@com.utcluj.ro, thodorogea@yahoo.com

  2. Content 1. Introduction 2. DNA Steganography 3. DNA Cryptography 4. Public Key Infrastructure (PKI) with DNA Cryptography 5. The algorithm by steps 5.1. The Technique of Deriving DNA Private Keys from Blood Analysis 5.2. Biological Principles of CDMB 6. Conclusions 7. References

  3. 1. Introduction • Protecting medical information and other data assetsusing a technique of deriving DNA private keys from blood analysis, into the common PKI scenario. • Synergetic minerals are used as a supplementary security technique in the coding process of data. • A DNA encryption technique is further developed here in which a person’s medical data is encrypted in DNA strands based on the Central Dogma of Molecular Biology (CDMB). • Protection of the data is enhanced by using a patient’s own blood mineral levels as a seed for selecting, transmitting and recovering that person’s private key.

  4. 2. DNA Steganography • Recent research considers the use of the Human genome • in cryptography • The spiritual concepts based on trinity and complementary that is considered in the DNA structure is able to be used in the cryptography process as an alternative technique. • The genetic code is based considering codons (consists of 3 nucleic acids from possible 4, as a 64 possible triplets) organised as a dual helix with complementary strands. • In 2000, the Junior Nobel Prize was awarded to a young • Romanian-American student, Viviana Risca, for her work • in DNA steganography.

  5. 1. Viviana Risca encoded a message in a strand of DNA2. A prototypical ‘secret message’ DNA strand contains an encoded message flanked by primer sequences 3. Viviana Risca confined the sample to an area no larger than a microdot.

  6. 3. DNA Cryptography • We propose to introduce DNA cryptography into the common PKI scenario • And encode the medical records of an individual in DNA data strand • Flanked by unique primer sequences • Unique primer sequences we obtain in the process of : Deriving DNA Private Key from blood analysis.

  7. Using an information conversion program Stefani encodes the medical records of an individual according to CDMB in DNA data strand flanked by unique primer sequences S1 mixes it among other decoy DNA strands and sends to the receiver through a public channel

  8. Otto then obtains the unique primer sequences • That mark the beginning and the end of secret data DNA strand hidden among the decoy strands. • Inthis last step, he uses the information conversion program and reads the medical record of the individual.

  9. 4.Public Key Infrastructure with DNA Cryptography

  10. 5. The algorithm by steps Start: Step 1.Stefani (the sender) provides Otto (the receiver) her public key which will constitute each unique blood analysis of the specific person.

  11. Step 2.A secret DNA data strand contains 3 parts: - Secret DNA data strand in the middle - Unique primer sequences on each side S1.

  12. Step 3. Stefani uses the technique of deriving DNA private key from blood analysis. 3.1 In this process Stefani uses a program which associates to a specific mineral the nucleotide sequence based on the medical results of a specific person -which will constitute the unique primer sequences S1

  13. 5.1. The Technique of Deriving DNA Private Keys from Blood Analysis 1. Starting from the idea that the DNA alphabet having 4 letters corresponding to the four nucleotides, A, C, G, T there are 64 possible triplet sequences or codons (4x4x4).

  14. A computer program generates a nucleotide sequenceS, of length L, according to the Genetic Code. We choose a numbern (dependent of the specific mineral value from the particular individual’s blood analysis), n represents the number of codons By a random combination of codons results : L=3*n(1) (Ex. L=3*5=15) 2.Then we associate a specific mineralM, with the corresponding nucleotide sequenceS.

  15. 3.Then we associate a specific mineral, M (like calcium), based on its concentration levelCL (Ex. 2.81mmol/l), with the new nucleotide sequence S1 We derive S1from nucleotide sequenceS, based on unique CL with value V . • This value represents a unique concentration level of a certain M. V= x.y1y2(Ex. 2.81) (2) • Where x.y1y2 is the number that represent the value V. => CL=x.y1y2(3)

  16. S= • The resultant new nucleotide sequence S1 will have the length L1 S1=L1 L1=x*S+ (L-(y1+y2)) (4) Ex. L1=2*GCAAGAGATAATTGT+(15-(8+1))=> L1 =GCAAGAGATAATTGTGCAAGAGATAATTGT+( 6 nucleotide)=> L1= GCAAGAGATAATTGTGCAAGAGATAATTGT+GCAAGA=> S1=GCAAGAGATAATTGTGCAAGAGATAATTGTGCAAGA => S1=x*S+ (L-(y1+y2)) (5) S1 will constitute the unique primer sequence (private key )

  17. Step 4: According to CDMB, using an information conversion program Stefani encodes the medical records of an individual in DNA data strand flanked by unique primer sequences S1 and mixes it among other decoy DNA strands.

  18. 5.2. Biological Principles of CDMB Transcription and Splicing : the non-coding areas (introns) are removed Translation: the mRNA sequence is translated into a sequence of amino acids

  19. 4.1According to CDMB during the process of transcription Stefani cuts out the introns from the data-encoded DNA, resulting in Encryption key 1. E1= starting and pattern codes of introns => C1=E1(P), where P is plaintext and C is the ciphertext. 4.2Stefani translates the resulted spliced form of the data E2= the codon amino acids mapping =>C=E2(C1). .

  20. 4.3Stefani obtains the data-encoded protein after the translation process. Step 5.Stefani sends to Otto through a public channel the encoded form of the data . Step 6. Otto then obtains the unique primer sequences that mark the beginning and the end of secret data DNA strand hidden among the decoy strands.

  21. Comments: Otto will use programs that perform the reverse processes as those performed by Stefani: simulating the transcription, splicing, and translation per the Central Dogma of Molecular Biology (CDMB). Step 6.Otto uses the key E2 to recover the mRNA form of the data from protein form of the data. Decryption keyD1=E2 => P1=D1(C).

  22. Step 7.Otto recovers the DNA form of the data in the reverse order as Stefani encrypted it. Decryption keyD2=E1=> P=D2(P1). Step 8.In this last step, Otto uses the information conversion program and reads the medical record of the individual. • Stop

  23. 5. Future Work • As an additional layer of security, we propose to associate each mineral with a corresponding mineral – which we will call here, a synergetic mineral pair – for example, Ca-Fe. In this process the primers could be synergetic minerals. • An implementation mechanism based on an adequate language capable to offer String processing facilities will be realized (Java). • We want to prove all this in practice not only in theory, comparing the results with the classical one’s. (dedicated packages are offered in Java)

  24. 6. Conclusions Blood analysis may prove to be a secure and cost effective biometric method of selecting private keys for use in DNA encryption techniques. New implementation techniques, as number association to specific codons that DNA supports with a more subtle significance, could be realized. Analyzing in a deeper mode some spiritual concepts (eneagrams, tetractis, I Ching, mandalas, morphic theory, etc.) from oriental philosophy and other ancient civilizations, it is possible to consider special properties that are in conjunction with the cryptology domain.

  25. 6. References 1. BOREM Aluízio Fabricio, R.Santos, 2003 Understanding Biotechnology Publisher: Prentice Hall PTRPub Date: January 17, 2003. 2. GEHANI Ashish, La Bean, Thomas H. Reif, JohnH, 1999 “DNA-Based Cryptography”, Department of Computer Science, Duke University. June 1999, 3. CHUVAKIN Anton, Cyrus Peikari, 2004, Security Warrior, Publisher: O'Reilly, Pub Date: January 2004 4. HODOROGEA Tatiana, Mircea-Florin Vaida, 2005, Alternate Cryptography Techniques, ICCC 2005, Miskolc-Lillafured, Hungary, 24-27 may 2005, Vol. 1, pp. 513-518 5. GARFINKEL Simson, 2001, Web Security, Privacy & Commerce, 2nd Edition, Publisher, O’Reilly, November 2001 6. GARFINKEL Simson, Lorrie Faith Cranor, 2005, Security and Usability, Publisher, O’Reilly, August 2005 7. KAHN D., 1967, The Codebrakers, McMillan, New York, 1967 8. KANG Ning, A Pseudo DNA Cryptography Method Independent Research Study Project for CS5231 9. TAYLOR ClellandCatherine, Viviana Risca, Carter Bancroft, 1999, “Hiding Messages in DNA Micodots”. Nature Magazine Vol.. 399, June 10, 1999. 10. VAIDA Mircea-Florin, 2004, Information Society Development and Human Evolution, ICCC 2004, Baile Felix, May 27-29, 2004, pp. 414-420 11. VAIDA Mircea-Florin, 2004, Security and Java, Conference at the Université de Savoie, France, supported by Shuffle project, May 2004 12. VAIDA Mircea-Florin 2005, Teaching Computers As a Human Spiritual Evolution, the 4th IASTED International Conference on Web-Based Education WBE’05, Grindelwald, Switzerland, pp. 667-672

  26. Thank you !

More Related