530 likes | 753 Vues
Jacek Błażewicz. Operations Research -. bridging gaps between Manufacturing and Biology. Presentation of our region. Presentation of our region. Presentation of our region. Siegen. Nodes. Arcs. GRAPHS. One of the main concepts used in Computer Science and Operations Research.
E N D
Jacek Błażewicz Operations Research - bridging gaps between Manufacturing and Biology
Nodes Arcs GRAPHS One of the main concepts used in Computer Science and Operations Research. Used to present different processes.
Jan Węglarz ` Poznań Jacek Błażewicz
Siegen Poznań Erwin Pesch
Clausthal-Zellerfeld Poznań Klaus Ecker Siegen
Clausthal-Zellerfeld Poznań Saarbrücken Günter Schmidt Siegen
Erwin Pesch Poznań Jacek Błażewicz Małgorzata Sterna Siegen
Redmond Poznań Siegen
Redmond Poznań Livermore Siegen
Erwin Pesch Redmond Siegen Poznań Livermore Jacek Błażewicz
Bartosz Nowierski Bartosz Nowierski Bartosz Nowierski Erwin Pesch Redmond Siegen Łukasz Szajkowski Łukasz Szajkowski Poznań Livermore Łukasz Szajkowski Jacek Błażewicz
Scheduling problems (deterministic) A set of mprocessors P1, P2, ..., Pm A set of n tasks T1, T2, ..., Tn Each task is characterized by - processing time - pj Precedence constraints TiTj
Preemptions P1 Tj Tl P2 Tk Tj t 0 Cj Cmax Criterion - Cmax = max{Cj}
Partial order Ti TjTypes of precedence graphs Independenttasks Dependent taskstask – on – node chains in-trees opposing forest out-trees TiTj
general graphs task – on - arc uniconnected activity network uan 2 T1 T4 1 4 T3 T2 T5 3
2 T1 T4 1 4 T3 T2 T5 3 Pm│pmtn,uan │Cmax a) Uniquely ordered event nodes.
b) An example of a simple uniconnected activity network (a) and the corresponding precedence graph (b). T1 T4 T3 T2 T5
NowLPformulation: Minimize Subject to j=1,2,...,n xj≥0 ComplexityK = O(nm)-a number of variables, thus for a fixed m the problem can be solved inpolynomial time[Khachiyan, Karmarkar]. [J.Błażewicz, W.Cellary, R.Słowiński, J.Węglarz, 77]
In practice: Polynomial time = easy (solvable in practice) NP-hard = difficult (not solvable in practice)
Theorem 1 Let G be an activity network (task-on-arc graph). G is uniconnected if and only if G has a Hamiltonian path.
Original graph G Hamiltonian Precedence graph H ?
Molecular biology • Chemical foundations of life • Information coded in chemical molecules Computational biology
Problems Methods Problems Methods Operations Research Molecular Biology
DNA recognition Human genome • pairs of bases • 3% nucleotides coding an information
Human genome 3000 books (valid information 90 books) 1 cell bacteria 20 books Some flies 5000books
Analyzed structures • One dimensional structures Analysis of DNA chains (and an information they carry on) • Two dimensional structures Analysis (and recognition) of substructures formed by consecutive subchains (e.g. Α-helix, β-harmony) • Three dimensional structures Analysis of 3-dimensional helix (NMR experiment) . . . . . A C G A T G C G A
One dimensional structures • Reading DNA chains • Understanding an information contained in DNA • sequence alignment • finding motifs in sequences • assigning functions to subsequences (or motifs)
Levels • Sequencing • up to 700 nucleotides • combinatorial exact methods • Assembling • up to 1000000 nucleotides • heuristics • Mapping • greater than 1000000 nucleotides • search in data bases
Genetic linkage map (works on 107-108 bp range) Chromosome Assembling (works on 105-106 bp range) Clones Sequencing (works on 103-104 bp range) CGGACACCGACGTCATTCTCATGTGCTTCTCGGCACA The different scales at which the human genome is studied
A A C A C G A C G T Round 1 A C G T A C G T A C G T A C G T A C G T A C G A A C Round 2 Hybridization Experiment 1. Making a DNA chip
A C G T A C G T Round 3 ... and so on ... DNA chip A A A A 44 – 0.0016 cm2 48 – 0.4096 cm2 410 – 6.5536 cm2 Full library of tetranucleotides 0,4mm 25m site per probe 0,4mm AAAA AACA AAGA AAAC AACC AAGC AAAT AACG AAGG AAAT AACT AAGT ACAA ACCA
. . . . . . . Hybridization Experiment –cont. 2. Hybridization reaction DNA chip TCCACTG... Many labeled copies of an original sequence 3. Reading results Fluorescence image of the chip Spectrum – a set of oligonucleotides complementary to fragments of original sequence spectrum
A hybridization reactionbetween a probe of known sequence (l-mer) and an unknown sequence (n-mer): n-mer - . . . A A C T A G A C C T . . . l-mer - G A T C T A A sequence complementary to the probe exists in the target
ACT AAC CTA CCT TAG AGA ACC GAC DNA sequencing without errors The original sequence: AACTAGACCT Spectrum = {AAC,ACT,CTA,TAG,AGA,GAC,ACC,CCT} (Two possible solutions: AACTAGACCT,AACCTAGACT) • Lysov (1988) A graph is based on l-mers (graph H) Finding a Hamiltonian path – NP-hard
Pevzner (1989) AAC AA AC A graph based on (l-1)-mers (graph G): AC AA CT TA AG CC GA A problem of equivalence A problem of uniqueness Finding an Eulerian path – polynomially solvable
Equivalence problem The above class of directed labeled graphs – DNA graphs. Characterization and recognition of these graphs and finding conditions for which the above transformation is possible. J.Błażewicz, A.Hertz, D.Kobler, D.de Werra, On some properties of DNA graphs, Discrete Applied Math., 1999.
Definition The directed line graphH = (V,U)of graph G = (X,V) is thegraph with vertex set V and such that there is an arc from vertex xto vertex yinHif and only if the terminal endpoint of arc x in G is the initial endpoint of arc y inG. Graph G – Pevzner graph Directed line graph H – Lysov graph
Theorem 2 Let Hbe the directed line-graph of a graph G. Then there is an Eulerianpath in G if and only if there is a Hamiltonian pathin H.
Back to scheduling. Original graph G Hamiltonian Its directed line-graph H ?
Theorem 3 Original graph G uan Hamiltonian Its directed line-graph H interval order. J.Błażewicz, D.Kobler European Journal of Operational Research, 2002